MirGeneDB

MirGeneDB ID

Aca-Mir-214-v1

Family name MIR-214 (all species)
Seed CAGCAGG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-214
Paralogues Aca-Mir-214-v2 
Orthologues Ami-Mir-214-v1  Bta-Mir-214-v1  Cfa-Mir-214-v1  Cli-Mir-214-v1  Cpi-Mir-214-v1  Cpo-Mir-214-v1  Dno-Mir-214-v1  Dre-Mir-214-v1  Ete-Mir-214-v1  Gga-Mir-214-v1  Hsa-Mir-214-v1  Mdo-Mir-214-v1  Mml-Mir-214-v1  Mmu-Mir-214-v1  Oan-Mir-214-v1  Ocu-Mir-214-v1  Rno-Mir-214-v1  Sha-Mir-214-v1  Sto-Mir-214-v1  Tgu-Mir-214-v1  Xtr-Mir-214-v1 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(anoCar2)
AAWZ02037129: 14630-14692 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-214-v1)
Mir-214-v1 AAWZ02037129: 14630-14692 [+] UCSC Ensembl
Mir-214-v2 AAWZ02037129: 14630-14692 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGGCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCUCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCUGAAAUACAGCCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGGCUGGCUGGACAGA--|          U          ACA          AGAACAUC 
                   GUUGUCAUGUG CUGCCUGUCU   CUUGCUGUGC        \
                   CAACAGUACAC GACGGACAGA   GGACGACAUG        C
ACCGACAUAAAGUCCGACC^          U          CAC          UCCACUCU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-214-v1_5p*

MirBase accessionMIMAT0021871
Sequence
0- UGCCUGUCUACACUUGCUGUGC -22
Get sequence
Mature sequence

Aca-Mir-214-v1_3p

MirBase accessionMIMAT0021872
Sequence
41- ACAGCAGGCACAGACAGGCAGU -63
Get sequence