MirGeneDB

MirGeneDB ID

Oan-Mir-214-v1

Family name MIR-214 (all species)
Seed GCCUGUC
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID oan-mir-214
Paralogues Oan-Mir-214-v2 
Orthologues Aca-Mir-214-v1  Ami-Mir-214-v1  Bta-Mir-214-v1  Cfa-Mir-214-v1  Cli-Mir-214-v1  Cpi-Mir-214-v1  Cpo-Mir-214-v1  Dno-Mir-214-v1  Dre-Mir-214-v1  Ete-Mir-214-v1  Gga-Mir-214-v1  Hsa-Mir-214-v1  Mdo-Mir-214-v1  Mml-Mir-214-v1  Mmu-Mir-214-v1  Ocu-Mir-214-v1  Rno-Mir-214-v1  Sha-Mir-214-v1  Sto-Mir-214-v1  Tgu-Mir-214-v1  Xtr-Mir-214-v1 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041743.1: 5349852-5349914 [-]
Clustered MiRNAs
(< 10kb from Mir-214-v1)
Mir-214-v1 NC_041743.1: 5349852-5349914 [-]
Mir-214-v2 NC_041743.1: 5349852-5349914 [-]
Mir-199-P3-v1 NC_041743.1: 5356219-5356279 [-]
Mir-199-P3-v2 NC_041743.1: 5356219-5356279 [-]
Mir-199-P3-v3 NC_041743.1: 5356219-5356279 [-]
Precursor
(pre-Mir +30nt flank)
GGGACUGGCUGGACGGAGUUGUCACGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCUCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCUGACUGACAACCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGACUGGCUGGACGGA--|      C   U          ACA          AGAACAUC 
                   GUUGUCA GUG CUGCCUGUCU   CUUGCUGUGC        \
                   CAACAGU CAC GACGGACAGA   GGACGACAUG        C
ACCAACAGUCAGUCCGACC^      A   U          CAC          UCCACUCU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Oan-Mir-214-v1_5p

MirBase accessionMIMAT0007170
Sequence
0- UGCCUGUCUACACUUGCUGUGC -22
Get sequence
Co-mature sequence

Oan-Mir-214-v1_3p

MirBase accessionMIMAT0007171
Sequence
41- ACAGCAGGCACAGACAGGCAGU -63
Get sequence