MirGeneDB

MirGeneDB ID

Aca-Mir-199-P1-v1

Family name MIR-199 (all species)
Seed CAGUAGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-199b
Paralogues Aca-Mir-199-P1-v2  Aca-Mir-199-P1-v3  Aca-Mir-199-P2-v1  Aca-Mir-199-P2-v2  Aca-Mir-199-P2-v3  Aca-Mir-199-P3-v1  Aca-Mir-199-P3-v2  Aca-Mir-199-P3-v3 
Orthologues Ami-Mir-199-P1-v1  Ami-Mir-199-P1-v2  Ami-Mir-199-P1-v3  Bta-Mir-199-P1-v1  Bta-Mir-199-P1-v2  Bta-Mir-199-P1-v3  Cfa-Mir-199-P1-v1  Cfa-Mir-199-P1-v2  Cfa-Mir-199-P1-v3  Cli-Mir-199-P1-v1  Cli-Mir-199-P1-v2  Cli-Mir-199-P1-v3  Cpi-Mir-199-P1-v1  Cpi-Mir-199-P1-v2  Cpi-Mir-199-P1-v3  Cpo-Mir-199-P1-v1  Cpo-Mir-199-P1-v2  Cpo-Mir-199-P1-v3  Dno-Mir-199-P1-v1  Dno-Mir-199-P1-v2  Dno-Mir-199-P1-v3  Dre-Mir-199-P1-v1  Dre-Mir-199-P1-v2  Dre-Mir-199-P1-v3  Ete-Mir-199-P1-v1  Ete-Mir-199-P1-v2  Ete-Mir-199-P1-v3  Gga-Mir-199-P1-v1  Gga-Mir-199-P1-v2  Gga-Mir-199-P1-v3  Hsa-Mir-199-P1-v1  Hsa-Mir-199-P1-v2  Hsa-Mir-199-P1-v3  Mdo-Mir-199-P1-v1  Mdo-Mir-199-P1-v2  Mdo-Mir-199-P1-v3  Mml-Mir-199-P1-v1  Mml-Mir-199-P1-v2  Mml-Mir-199-P1-v3  Mmu-Mir-199-P1-v1  Mmu-Mir-199-P1-v2  Mmu-Mir-199-P1-v3  Oan-Mir-199-P1-v1  Oan-Mir-199-P1-v2  Oan-Mir-199-P1-v3  Ocu-Mir-199-P1-v1  Ocu-Mir-199-P1-v2  Ocu-Mir-199-P1-v3  Rno-Mir-199-P1-v1  Rno-Mir-199-P1-v2  Rno-Mir-199-P1-v3  Sha-Mir-199-P1-v1  Sha-Mir-199-P1-v2  Sha-Mir-199-P1-v3  Sto-Mir-199-P1-v1  Sto-Mir-199-P1-v2  Sto-Mir-199-P1-v3  Tgu-Mir-199-P1-v1  Tgu-Mir-199-P1-v2  Tgu-Mir-199-P1-v3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343763.1: 95918-95978 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-199-P1-v1)
Mir-199-P1-v1 GL343763.1: 95918-95978 [+] UCSC Ensembl
Mir-199-P1-v2 GL343763.1: 95918-95978 [+] UCSC Ensembl
Mir-199-P1-v3 GL343763.1: 95918-95978 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGGUCGACACAGAGCCUCCACUCCGUCUGCCCAGUGUUCGGACUACCUGUUCAGGACUACGAGAUUGUACAGUAGUCUGCACAUUGGUUAGGCUGUGCUGGGAUAUACCGCAUACACAGU
Get precursor sequence
Structure
        10         20         30        40        50        60
UUGGUCGACACAGAGCC-    CUCC-|    C       U        C   U AGGACU 
                  UCCA     GUCUG CCAGUGU CGGACUAC UGU C      A
                  GGGU     CGGAU GGUUACA GUCUGAUG ACA G      C
UGACACAUACGCCAUAUA    CGUGU^    U       C        -   U UUAGAG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-199-P1-v1_5p*

MirBase accessionMIMAT0021835
Sequence
0- CCCAGUGUUCGGACUACCUGUUC -23
Get sequence
Mature sequence

Aca-Mir-199-P1-v1_3p

MirBase accessionNone
Sequence
39- ACAGUAGUCUGCACAUUGGUUA -61
Get sequence