MirGeneDB

MirGeneDB ID

Ocu-Mir-199-P1-v1

Family name MIR-199 (all species)
Seed CAGUAGU
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID
Paralogues Ocu-Mir-199-P1-v2  Ocu-Mir-199-P1-v3  Ocu-Mir-199-P2-v1  Ocu-Mir-199-P2-v2  Ocu-Mir-199-P2-v3  Ocu-Mir-199-P3-v1  Ocu-Mir-199-P3-v2  Ocu-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P1-v1  Aca-Mir-199-P1-v2  Aca-Mir-199-P1-v3  Ami-Mir-199-P1-v1  Ami-Mir-199-P1-v2  Ami-Mir-199-P1-v3  Bta-Mir-199-P1-v1  Bta-Mir-199-P1-v2  Bta-Mir-199-P1-v3  Cfa-Mir-199-P1-v1  Cfa-Mir-199-P1-v2  Cfa-Mir-199-P1-v3  Cli-Mir-199-P1-v1  Cli-Mir-199-P1-v2  Cli-Mir-199-P1-v3  Cpi-Mir-199-P1-v1  Cpi-Mir-199-P1-v2  Cpi-Mir-199-P1-v3  Cpo-Mir-199-P1-v1  Cpo-Mir-199-P1-v2  Cpo-Mir-199-P1-v3  Dno-Mir-199-P1-v1  Dno-Mir-199-P1-v2  Dno-Mir-199-P1-v3  Dre-Mir-199-P1-v1  Dre-Mir-199-P1-v2  Dre-Mir-199-P1-v3  Ete-Mir-199-P1-v1  Ete-Mir-199-P1-v2  Ete-Mir-199-P1-v3  Gga-Mir-199-P1-v1  Gga-Mir-199-P1-v2  Gga-Mir-199-P1-v3  Hsa-Mir-199-P1-v1  Hsa-Mir-199-P1-v2  Hsa-Mir-199-P1-v3  Mdo-Mir-199-P1-v1  Mdo-Mir-199-P1-v2  Mdo-Mir-199-P1-v3  Mml-Mir-199-P1-v1  Mml-Mir-199-P1-v2  Mml-Mir-199-P1-v3  Mmu-Mir-199-P1-v1  Mmu-Mir-199-P1-v2  Mmu-Mir-199-P1-v3  Oan-Mir-199-P1-v1  Oan-Mir-199-P1-v2  Oan-Mir-199-P1-v3  Rno-Mir-199-P1-v1  Rno-Mir-199-P1-v2  Rno-Mir-199-P1-v3  Sha-Mir-199-P1-v1  Sha-Mir-199-P1-v2  Sha-Mir-199-P1-v3  Sto-Mir-199-P1-v1  Sto-Mir-199-P1-v2  Sto-Mir-199-P1-v3  Tgu-Mir-199-P1-v1  Tgu-Mir-199-P1-v2  Tgu-Mir-199-P1-v3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(oryCun2)
2005146567_corrected: 71-131 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUGGACCAGAGGAUACCUCCCCUCCGUCUACCCAGUGUUUAGACUAUCUGUUCAGGACUCCCAAAUUGUACAGUAGUCUGCACAUUGGUUAGAAUCCACCACAUGGAGCUANNNNNNNNNN
Get precursor sequence
Structure
        10        20          30        40        50        60
AUGGACCAGAGGAUACCUCCCCUCCG--|   C       U       U    U AGGACU 
                            UCUA CCAGUGU UAGACUA CUGU C      C
                            AGAU GGUUACA GUCUGAU GACA G      C
NNNNNNNNNNAUCGAGGUACACCACCUA^   U       C       -    U UUAAAC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsNo
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-199-P1-v1_5p*

MirBase accessionNone
Sequence
0- CCCAGUGUUUAGACUAUCUGUUC -23
Get sequence
Mature sequence

Ocu-Mir-199-P1-v1_3p

MirBase accessionNone
Sequence
39- ACAGUAGUCUGCACAUUGGUUA -61
Get sequence