MirGeneDB

MirGeneDB ID

Ocu-Mir-214-v2

Family name MIR-214 (all species)
Seed ACAGCAG
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-214
Paralogues Ocu-Mir-214-v1 
Orthologues Aca-Mir-214-v2  Ami-Mir-214-v2  Bta-Mir-214-v2  Cfa-Mir-214-v2  Cli-Mir-214-v2  Cpi-Mir-214-v2  Cpo-Mir-214-v2  Dno-Mir-214-v2  Dre-Mir-214-v2  Ete-Mir-214-v2  Gga-Mir-214-v2  Hsa-Mir-214-v2  Mdo-Mir-214-v2  Mml-Mir-214-v2  Mmu-Mir-214-v2  Oan-Mir-214-v2  Rno-Mir-214-v2  Sha-Mir-214-v2  Sto-Mir-214-v2  Tgu-Mir-214-v2  Xtr-Mir-214-v2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(oryCun2)
chr13: 20634041-20634103 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-214-v2)
Mir-199-P3-v1 chr13: 20628416-20628476 [+] UCSC Ensembl
Mir-199-P3-v2 chr13: 20628416-20628476 [+] UCSC Ensembl
Mir-199-P3-v3 chr13: 20628416-20628476 [+] UCSC Ensembl
Mir-214-v1 chr13: 20634041-20634103 [+] UCSC Ensembl
Mir-214-v2 chr13: 20634041-20634103 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGCCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCGCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCUGAAUGACCACCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGCCUGGCUGGACAGA--|          U          ACA           GAACAUC 
                   GUUGUCAUGUG CUGCCUGUCU   CUUGCUGUGCA       \
                   CAACAGUACAC GACGGACAGA   GGACGACAUGU       C
ACCACCAGUAAGUCCGACC^          U          CAC           CCACUCG 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-214-v2_5p*

MirBase accessionMIMAT0048337
Sequence
0- UGCCUGUCUACACUUGCUGUGCA -23
Get sequence
Mature sequence

Ocu-Mir-214-v2_3p

MirBase accessionMIMAT0048338
Sequence
40- UACAGCAGGCACAGACAGGCAGU -63
Get sequence