MirGeneDB

MirGeneDB ID

Aca-Mir-214-v2

Family name MIR-214 (all species)
Seed ACAGCAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-214
Paralogues Aca-Mir-214-v1 
Orthologues Ami-Mir-214-v2  Bta-Mir-214-v2  Cfa-Mir-214-v2  Cli-Mir-214-v2  Cpi-Mir-214-v2  Cpo-Mir-214-v2  Dno-Mir-214-v2  Dre-Mir-214-v2  Ete-Mir-214-v2  Gga-Mir-214-v2  Hsa-Mir-214-v2  Mdo-Mir-214-v2  Mml-Mir-214-v2  Mmu-Mir-214-v2  Oan-Mir-214-v2  Ocu-Mir-214-v2  Rno-Mir-214-v2  Sha-Mir-214-v2  Sto-Mir-214-v2  Tgu-Mir-214-v2  Xtr-Mir-214-v2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Gnathostomata
Genome context
(anoCar2)
AAWZ02037129: 14630-14692 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-214-v2)
Mir-214-v1 AAWZ02037129: 14630-14692 [+] UCSC Ensembl
Mir-214-v2 AAWZ02037129: 14630-14692 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGGCUGGCUGGACAGAGUUGUCAUGUGUCUGCCUGUCUACACUUGCUGUGCAGAACAUCCUCUCACCUGUACAGCAGGCACAGACAGGCAGUCACAUGACAACCCAGCCUGAAAUACAGCCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
GGGGCUGGCUGGACAGA--|          U          ACA           GAACAUC 
                   GUUGUCAUGUG CUGCCUGUCU   CUUGCUGUGCA       \
                   CAACAGUACAC GACGGACAGA   GGACGACAUGU       C
ACCGACAUAAAGUCCGACC^          U          CAC           CCACUCU 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-214-v2_5p*

MirBase accessionMIMAT0021871
Sequence
0- UGCCUGUCUACACUUGCUGUGCA -23
Get sequence
Mature sequence

Aca-Mir-214-v2_3p

MirBase accessionMIMAT0021872
Sequence
40- UACAGCAGGCACAGACAGGCAGU -63
Get sequence