MirGeneDB

MirGeneDB ID

Sha-Mir-199-P1-v2

Family name MIR-199 (all species)
Seed ACAGUAG
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID
Paralogues Sha-Mir-199-P1-v1  Sha-Mir-199-P1-v3  Sha-Mir-199-P2-v1  Sha-Mir-199-P2-v2  Sha-Mir-199-P2-v3  Sha-Mir-199-P3-v1  Sha-Mir-199-P3-v2  Sha-Mir-199-P3-v3 
Orthologues Aca-Mir-199-P1-v1  Aca-Mir-199-P1-v2  Aca-Mir-199-P1-v3  Ami-Mir-199-P1-v1  Ami-Mir-199-P1-v2  Ami-Mir-199-P1-v3  Bta-Mir-199-P1-v1  Bta-Mir-199-P1-v2  Bta-Mir-199-P1-v3  Cfa-Mir-199-P1-v1  Cfa-Mir-199-P1-v2  Cfa-Mir-199-P1-v3  Cli-Mir-199-P1-v1  Cli-Mir-199-P1-v2  Cli-Mir-199-P1-v3  Cpi-Mir-199-P1-v1  Cpi-Mir-199-P1-v2  Cpi-Mir-199-P1-v3  Cpo-Mir-199-P1-v1  Cpo-Mir-199-P1-v2  Cpo-Mir-199-P1-v3  Dno-Mir-199-P1-v1  Dno-Mir-199-P1-v2  Dno-Mir-199-P1-v3  Dre-Mir-199-P1-v1  Dre-Mir-199-P1-v2  Dre-Mir-199-P1-v3  Ete-Mir-199-P1-v1  Ete-Mir-199-P1-v2  Ete-Mir-199-P1-v3  Gga-Mir-199-P1-v1  Gga-Mir-199-P1-v2  Gga-Mir-199-P1-v3  Hsa-Mir-199-P1-v1  Hsa-Mir-199-P1-v2  Hsa-Mir-199-P1-v3  Mdo-Mir-199-P1-v1  Mdo-Mir-199-P1-v2  Mdo-Mir-199-P1-v3  Mml-Mir-199-P1-v1  Mml-Mir-199-P1-v2  Mml-Mir-199-P1-v3  Mmu-Mir-199-P1-v1  Mmu-Mir-199-P1-v2  Mmu-Mir-199-P1-v3  Oan-Mir-199-P1-v1  Oan-Mir-199-P1-v2  Oan-Mir-199-P1-v3  Ocu-Mir-199-P1-v1  Ocu-Mir-199-P1-v2  Ocu-Mir-199-P1-v3  Rno-Mir-199-P1-v1  Rno-Mir-199-P1-v2  Rno-Mir-199-P1-v3  Sto-Mir-199-P1-v1  Sto-Mir-199-P1-v2  Sto-Mir-199-P1-v3  Tgu-Mir-199-P1-v1  Tgu-Mir-199-P1-v2  Tgu-Mir-199-P1-v3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(DEVIL7_traces)
GL838915.1: 7112-7172 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACAGAAGGACACAGACUCCACUCCGUCUACCCAGUGUUUAGACUAUCUGUUCAGGACUCCAAUAUUGUACAGUAGUCUGCACAUUGGUUAGGCUGGGCUGGGCUACACACGGUGUCGUGC
Get precursor sequence
Structure
        10         20         30        40        50        60
GACAGAAGGACACAGAC-    CU  -|    C       U       U    U  GGACU 
                  UCCA  CC GUCUA CCAGUGU UAGACUA CUGU CA     C
                  GGGU  GG CGGAU GGUUACA GUCUGAU GACA GU     C
CGUGCUGUGGCACACAUC    CG  U^    U       C       -    U  UAUAA 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Star sequence

Sha-Mir-199-P1-v2_5p*

MirBase accessionNone
Sequence
0- CCCAGUGUUUAGACUAUCUGUUCA -24
Get sequence
Mature sequence

Sha-Mir-199-P1-v2_3p

MirBase accessionNone
Sequence
38- UACAGUAGUCUGCACAUUGGUUA -61
Get sequence