MirGeneDB

MirGeneDB ID

Aca-Mir-194-P2

Family name MIR-194 (all species)
Seed GUAACAG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-194-1
Paralogues Aca-Mir-194-P1 
Orthologues Ami-Mir-194-P2  Bta-Mir-194-P2  Cfa-Mir-194-P2  Cli-Mir-194-P2  Cpi-Mir-194-P2  Ete-Mir-194-P2  Gga-Mir-194-P2  Hsa-Mir-194-P2  Mml-Mir-194-P2  Mmu-Mir-194-P2  Oan-Mir-194-P2  Ocu-Mir-194-P2  Rno-Mir-194-P2  Sto-Mir-194-P2  Tgu-Mir-194-P2a  Tgu-Mir-194-P2b  Xtr-Mir-194-P2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 243290942-243290997 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-194-P2)
Mir-192-P2 1: 243290668-243290728 [-] UCSC Ensembl
Mir-194-P2 1: 243290942-243290997 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGGUGUUUCAACCAUACAGUGUCGUCAAGUGUAACAGCAACUCCAUGUGGAAUAAGUAGAUUUCCAGUGGAGGUGCUGUUACUUUUGAAGCUACUGACCAAACGUUGAAGUGAAU
Get precursor sequence
Structure
        10          20        30        40        50        
GGGGUGUUUCAACCAUA--|    UCG     U         A      G     UAAG 
                   CAGUG   UCAAG GUAACAGCA CUCCAU UGGAA    \
                   GUCAU   AGUUU CAUUGUCGU GAGGUG ACCUU    U
UAAGUGAAGUUGCAAACCA^    CGA     U         G      -     UAGA 
    110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-194-P2_5p

MirBase accessionMIMAT0021828
Sequence
0- UGUAACAGCAACUCCAUGUGGAA -23
Get sequence
Star sequence

Aca-Mir-194-P2_3p*

MirBase accessionMIMAT0021829
Sequence
34- CCAGUGGAGGUGCUGUUACUUU -56
Get sequence