MirGeneDB

MirGeneDB ID

Rno-Mir-194-P2

Family name MIR-194 (all species)
Seed GUAACAG
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-194-1
Paralogues Rno-Mir-194-P1 
Orthologues Aca-Mir-194-P2  Ami-Mir-194-P2  Bta-Mir-194-P2  Cfa-Mir-194-P2  Cli-Mir-194-P2  Cpi-Mir-194-P2  Ete-Mir-194-P2  Gga-Mir-194-P2  Hsa-Mir-194-P2  Mml-Mir-194-P2  Mmu-Mir-194-P2  Oan-Mir-194-P2  Ocu-Mir-194-P2  Sto-Mir-194-P2  Tgu-Mir-194-P2a  Tgu-Mir-194-P2b  Xtr-Mir-194-P2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr13: 103250590-103250646 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUUCUCCGUCAAGCUUAUGGAGUCAUCACGUGUAACAGCAACUCCAUGUGGACUGUGCACAGAUCCCAGUGGAGCUGCUGUUACUUUUGAUGGCCUCCAGCCUGCUACAAACACUGG
Get precursor sequence
Structure
        10         20         30        40        50        
GUUCUCCGUCAAGCUUA-    -|      CGU         A      GU   CUGUG 
                  UGGA GUCAUCA   GUAACAGCA CUCCAU  GGA     \
                  ACCU CGGUAGU   CAUUGUCGU GAGGUG  CCU     C
GGUCACAAACAUCGUCCG    C^      UUU         C      AC   AGACA 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-194-P2_5p

MirBase accessionMIMAT0000869
Sequence
0- UGUAACAGCAACUCCAUGUGGAC -23
Get sequence
Validated targets microrna.org: MIMAT0000869
TargetScanVert: rno-miR-194-5p
miRDB: MIMAT0000869
Star sequence

Rno-Mir-194-P2_3p*

MirBase accessionNone
Sequence
35- CCAGUGGAGCUGCUGUUACUUU -57
Get sequence