MirGeneDB

MirGeneDB ID

Aca-Mir-192-P2

Family name MIR-192 (all species)
Seed UGACCUA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-215
Paralogues
Orthologues Ami-Mir-192-P2  Bta-Mir-192-P2  Cfa-Mir-192-P2  Cli-Mir-192-P2  Cpi-Mir-192-P2  Cpo-Mir-192-P2  Dno-Mir-192-P2  Ete-Mir-192-P2  Gga-Mir-192-P2  Hsa-Mir-192-P2  Mdo-Mir-192-P2  Mml-Mir-192-P2  Mmu-Mir-192-P2  Oan-Mir-192-P2  Oan-Mir-192-P2-as  Ocu-Mir-192-P2  Rno-Mir-192-P2  Sto-Mir-192-P2  Tgu-Mir-192-P2  Xtr-Mir-192-P2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 243290668-243290728 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-192-P2)
Mir-192-P2 1: 243290668-243290728 [-] UCSC Ensembl
Mir-194-P2 1: 243290942-243290997 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUUCCUGCUCAAAAUGGAGGCUUAGGGUAAUGACCUAUGAUUUGACAGACUGUGCUUUCUAUGUCUGCCUGUCAUUUCUGUAGGCCAAUACUCUGUACGCCCUCACUACUCUACAAAGAA
Get precursor sequence
Structure
        10        20          30         40        50         
UGUUCCUGCUCAAAAUGGA   U--       A  A     -| UU      ACUGUGCUU 
                   GGC   UAGGGUA UG CCUAU GA  UGACAG         U
                   CCG   GUCUCAU AC GGAUG CU  ACUGUC         C
AAGAAACAUCUCAUCACUC   CAU       A  C     U^ UU      CGUCUGUAU 
 .       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-192-P2_5p

MirBase accessionMIMAT0021873
Sequence
0- AUGACCUAUGAUUUGACAGACU -22
Get sequence
Star sequence

Aca-Mir-192-P2_3p*

MirBase accessionMIMAT0021874
Sequence
38- CCUGUCAUUUCUGUAGGCCAAUA -61
Get sequence