MirGeneDB

MirGeneDB ID

Rno-Mir-192-P2

Family name MIR-192 (all species)
Seed UGACCUA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-215
Paralogues Rno-Mir-192-P1 
Orthologues Aca-Mir-192-P2  Ami-Mir-192-P2  Bta-Mir-192-P2  Cfa-Mir-192-P2  Cli-Mir-192-P2  Cpi-Mir-192-P2  Cpo-Mir-192-P2  Dno-Mir-192-P2  Ete-Mir-192-P2  Gga-Mir-192-P2  Hsa-Mir-192-P2  Mdo-Mir-192-P2  Mml-Mir-192-P2  Mmu-Mir-192-P2  Oan-Mir-192-P2  Oan-Mir-192-P2-as  Ocu-Mir-192-P2  Sto-Mir-192-P2  Tgu-Mir-192-P2  Xtr-Mir-192-P2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(rn6)
159423064: 546-604 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGCUCUCACCAUGACCGGUGUACAGGACAAUGACCUAUGAUUUGACAGACAGUGUGGCUGCGUGUGUCUGUCAUUCUGUAGGCCAAUAUUCUGUAUGUCUCUCCUCCUUACAAACCAG
Get precursor sequence
Structure
        10          20        30         40        50         
GGGCUCUCACCAUGACC-- GU        CAA  A     -| UU         GUGUGG 
                   G  GUACAGGA   UG CCUAU GA  UGACAGACA      \
                   C  UAUGUCUU   AC GGAUG CU  ACUGUCUGU      C
GACCAAACAUUCCUCCUCU UG        AUA  C     U^ U-         GUGCGU 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-192-P2_5p

MirBase accessionMIMAT0003118
Sequence
0- AUGACCUAUGAUUUGACAGACA -22
Get sequence
Validated targets microrna.org: MIMAT0003118
TargetScanVert: rno-miR-215
miRDB: MIMAT0003118
Star sequence

Rno-Mir-192-P2_3p*

MirBase accessionNone
Sequence
37- UCUGUCAUUCUGUAGGCCAAUA -59
Get sequence