MirGeneDB

MirGeneDB ID

Mmu-Mir-192-P2

Family name MIR-192 (all species)
Seed UGACCUA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-215
Paralogues Mmu-Mir-192-P1 
Orthologues Aca-Mir-192-P2  Ami-Mir-192-P2  Bta-Mir-192-P2  Cfa-Mir-192-P2  Cli-Mir-192-P2  Cpi-Mir-192-P2  Cpo-Mir-192-P2  Dno-Mir-192-P2  Ete-Mir-192-P2  Gga-Mir-192-P2  Hsa-Mir-192-P2  Mdo-Mir-192-P2  Mml-Mir-192-P2  Oan-Mir-192-P2  Oan-Mir-192-P2-as  Ocu-Mir-192-P2  Rno-Mir-192-P2  Sto-Mir-192-P2  Tgu-Mir-192-P2  Xtr-Mir-192-P2 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr1: 185313610-185313668 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-192-P2)
Mir-194-P2 chr1: 185313325-185313381 [+] UCSC Ensembl
Mir-192-P2 chr1: 185313610-185313668 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGCUCUCAGCAUCAACGGUGUACAGGAGAAUGACCUAUGAUUUGACAGACCGUGCAGCUGUGUAUGUCUGUCAUUCUGUAGGCCAAUAUUCUGUAUGUCACUGCUACUUAAAAUCCGG
Get precursor sequence
Structure
        10          20        30         40        50         
GAGCUCUCAGCAUCAAC-- GU        GAA  A     -| UU        CGUGCAG 
                   G  GUACAGGA   UG CCUAU GA  UGACAGAC       \
                   C  UAUGUCUU   AC GGAUG CU  ACUGUCUG       C
GGCCUAAAAUUCAUCGUCA UG        AUA  C     U^ U-        UAUGUGU 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-192-P2_5p

MirBase accessionMIMAT0000904
Sequence
0- AUGACCUAUGAUUUGACAGACC -22
Get sequence
Validated targets microrna.org: MIMAT0000904
TargetScanVert: mmu-miR-215-5p
miRDB: MIMAT0000904
Star sequence

Mmu-Mir-192-P2_3p*

MirBase accessionMIMAT0017169
Sequence
37- UCUGUCAUUCUGUAGGCCAAUA -59
Get sequence
Validated targets TargetScanVert: mmu-miR-215-3p
miRDB: MIMAT0017169