MirGeneDB

MirGeneDB ID

Tgu-Mir-146-P1

Family name MIR-146 (all species)
Seed GAGAACU
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-146c
Paralogues Tgu-Mir-146-P2  Tgu-Mir-146-P3 
Orthologues Ami-Mir-146-P1  Bta-Mir-146-P1-v1  Bta-Mir-146-P1-v2  Cfa-Mir-146-P1  Cli-Mir-146-P1  Cpi-Mir-146-P1  Cpo-Mir-146-P1  Dno-Mir-146-P1  Dre-Mir-146-P1-v1  Dre-Mir-146-P1-v2  Gga-Mir-146-P1  Hsa-Mir-146-P1  Mdo-Mir-146-P1  Mml-Mir-146-P1  Mmu-Mir-146-P1  Oan-Mir-146-P1  Ocu-Mir-146-P1  Rno-Mir-146-P1  Sha-Mir-146-P1  Sto-Mir-146-o1  Xtr-Mir-146-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
13: 11635098-11635161 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGAAAAUGAAUGUCAUUUAUUCUCAGCUUUGAGAACUGAAUUCCAUGGGUUGUAAUUGAAUCUGCUGUCAGACCCAUGGGGCUCAGUUCUUCAGCUUGGAUAUUUCUGUCUUCACAUACACAG
Get precursor sequence
Structure
        10        20          30        40        50        60  
CUGAAAAUGAAUGUCAUUUAU--|  C    UU         A           GUAAUUGAA 
                       UCU AGCU  GAGAACUGA UUCCAUGGGUU         \
                       AGG UCGA  UUCUUGACU GGGGUACCCAG         U
GACACAUACACUUCUGUCUUUAU^  U    C-         C           ACUGUCGUC 
  120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-146-P1_5p

MirBase accessionMIMAT0014609
Sequence
0- UGAGAACUGAAUUCCAUGGGUUG -23
Get sequence
Star sequence

Tgu-Mir-146-P1_3p*

MirBase accessionNone
Sequence
42- ACCCAUGGGGCUCAGUUCUUCA -64
Get sequence