MirGeneDB

MirGeneDB ID

Cli-Mir-146-P1

Family name MIR-146 (all species)
Seed GAGAACU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-146a
Paralogues Cli-Mir-146-P2  Cli-Mir-146-P3 
Orthologues Ami-Mir-146-P1  Bta-Mir-146-P1-v1  Bta-Mir-146-P1-v2  Cfa-Mir-146-P1  Cpi-Mir-146-P1  Cpo-Mir-146-P1  Dno-Mir-146-P1  Dre-Mir-146-P1-v1  Dre-Mir-146-P1-v2  Gga-Mir-146-P1  Hsa-Mir-146-P1  Mdo-Mir-146-P1  Mml-Mir-146-P1  Mmu-Mir-146-P1  Oan-Mir-146-P1  Ocu-Mir-146-P1  Rno-Mir-146-P1  Sha-Mir-146-P1  Sto-Mir-146-o1  Tgu-Mir-146-P1  Xtr-Mir-146-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold79: 8894981-8895044 [+]
Precursor
(pre-Mir +30nt flank)
CUUAAAAUGAAUGUCGUGUAUUCUCAGCUUUGAGAACUGAAUUCCAUGGGUUGUAAUUGAAUUCGCUGUCAGACCCAUGGGGCUCAGUUCUUCAGCUUGGAUAUUUCUGUCUUCACAUACACAG
Get precursor sequence
Structure
        10           20        30        40        50        60  
CUUAAAAUGAAUGUCGU---|     UC    UU         A           GUAAUUGAA 
                    GUAUUC  AGCU  GAGAACUGA UUCCAUGGGUU         \
                    UAUAGG  UCGA  UUCUUGACU GGGGUACCCAG         U
GACACAUACACUUCUGUCUU^     U-    C-         C           ACUGUCGCU 
  120       110       100          90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-146-P1_5p

MirBase accessionMIMAT0038535
Sequence
0- UGAGAACUGAAUUCCAUGGGUUG -23
Get sequence
Star sequence

Cli-Mir-146-P1_3p*

MirBase accessionMIMAT0038536
Sequence
42- ACCCAUGGGGCUCAGUUCUUCA -64
Get sequence