MirGeneDB

MirGeneDB ID

Rno-Mir-1-P2

Family name MIR-1 (all species)
Seed GGAAUGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-1
Paralogues Rno-Mir-1-P1  Rno-Mir-1-P3 
Orthologues Aae-Mir-1  Aca-Mir-1-P2  Ami-Mir-1-P2  Asu-Mir-1  Bfl-Mir-1  Bge-Mir-1  Bta-Mir-1-P2  Cbr-Mir-1  Cel-Mir-1  Cfa-Mir-1-P2  Cgi-Mir-1  Cin-Mir-1  Cli-Mir-1-P2  Cpi-Mir-1-P2  Cpo-Mir-1-P2  Cte-Mir-1  Dan-Mir-1  Dme-Mir-1  Dmo-Mir-1  Dno-Mir-1-P2  Dpu-Mir-1  Dre-Mir-1-P2  Ete-Mir-1-P2  Gga-Mir-1-P2  Hme-Mir-1  Hsa-Mir-1-P2  Isc-Mir-1  Lan-Mir-1  Lgi-Mir-1  Mdo-Mir-1-P2  Mml-Mir-1-P2  Mmu-Mir-1-P2  Oan-Mir-1-P2  Ocu-Mir-1-P2  Pfl-Mir-1  Pmi-Mir-1  Sha-Mir-1-P2  Sko-Mir-1  Spu-Mir-1  Sto-Mir-1-P2  Tca-Mir-1  Tgu-Mir-1-P2  Xtr-Mir-1-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr18: 2054945-2055005 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-1-P2)
Mir-133-P2-v1 chr18: 2052491-2052550 [-] UCSC Ensembl
Mir-133-P2-v2 chr18: 2052491-2052550 [-] UCSC Ensembl
Mir-1-P2 chr18: 2054945-2055005 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAAUCGGCACAAUAGUGCCUACUCAGAGCACAUACUUCUUUAUGUACCCAUAUGAACAUAGAAUGCUAUGGAAUGUAAAGAAGUGUGUAUUUUGGGUAGGUAAUGUCCGCCAAGAAGAAG
Get precursor sequence
Structure
        10          20        30        40        50        60
ACAAUCGGCACAAUAGU--|           C                AC    AUGAACA 
                   GCCUACUCAGAG ACAUACUUCUUUAUGU  CCAU       U
                   UGGAUGGGUUUU UGUGUGAAGAAAUGUA  GGUA       A
GAAGAAGAACCGCCUGUAA^           A                A-    UCGUAAG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-1-P2_5p*

MirBase accessionMIMAT0003162
Sequence
0- ACAUACUUCUUUAUGUACCCAU -22
Get sequence
Validated targets microrna.org: MIMAT0003162
TargetScanVert: rno-miR-1-5p
miRDB: MIMAT0003162
Mature sequence

Rno-Mir-1-P2_3p

MirBase accessionMIMAT0003125
Sequence
39- UGGAAUGUAAAGAAGUGUGUAU -61
Get sequence
Validated targets microrna.org: MIMAT0003125
TargetScanVert: rno-miR-1-3p
miRDB: MIMAT0003125