MirGeneDB

MirGeneDB ID

Cli-Mir-1-P2

Family name MIR-1 (all species)
Seed GGAAUGU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-1a-2
Paralogues Cli-Mir-1-P1  Cli-Mir-1-P3  Cli-Mir-1-P4 
Orthologues Aae-Mir-1  Aca-Mir-1-P2  Ami-Mir-1-P2  Asu-Mir-1  Bfl-Mir-1  Bge-Mir-1  Bta-Mir-1-P2  Cbr-Mir-1  Cel-Mir-1  Cfa-Mir-1-P2  Cgi-Mir-1  Cin-Mir-1  Cpi-Mir-1-P2  Cpo-Mir-1-P2  Cte-Mir-1  Dan-Mir-1  Dme-Mir-1  Dmo-Mir-1  Dno-Mir-1-P2  Dpu-Mir-1  Dre-Mir-1-P2  Ete-Mir-1-P2  Gga-Mir-1-P2  Hme-Mir-1  Hsa-Mir-1-P2  Isc-Mir-1  Lan-Mir-1  Lgi-Mir-1  Mdo-Mir-1-P2  Mml-Mir-1-P2  Mmu-Mir-1-P2  Oan-Mir-1-P2  Ocu-Mir-1-P2  Pfl-Mir-1  Pmi-Mir-1  Rno-Mir-1-P2  Sha-Mir-1-P2  Sko-Mir-1  Spu-Mir-1  Sto-Mir-1-P2  Tca-Mir-1  Tgu-Mir-1-P2  Xtr-Mir-1-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold23: 298717-298777 [-]
Clustered MiRNAs
(< 10kb from Mir-1-P2)
Mir-133-P2-v1 scaffold23: 295639-295698 [-]
Mir-133-P2-v2 scaffold23: 295639-295698 [-]
Mir-1-P2 scaffold23: 298717-298777 [-]
Precursor
(pre-Mir +30nt flank)
CUGACAGCUCUGUGUGUACCUGCCCAGAGUACAUACUUCUUUAUGUACCCAUAUGAACAUACAAUGCUAUGGAAUGUAAAGAAGUAUGUAUUUUUGGCAGGCAUGGAACUACCAGUAAGAG
Get precursor sequence
Structure
        10          20        30        40        50        60
CUGACAGCUCUGUGUGUA--|     C                     AC     UGAACA 
                    CCUGCC AGAGUACAUACUUCUUUAUGU  CCAUA      U
                    GGACGG UUUUAUGUAUGAAGAAAUGUA  GGUAU      A
GAGAAUGACCAUCAAGGUAC^     U                     A-     CGUAAC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-1-P2_5p*

MirBase accessionMIMAT0038393
Sequence
0- ACAUACUUCUUUAUGUACCCAUA -23
Get sequence
Mature sequence

Cli-Mir-1-P2_3p

MirBase accessionMIMAT0038392
Sequence
39- UGGAAUGUAAAGAAGUAUGUAU -61
Get sequence