MirGeneDB

MirGeneDB ID

Rno-Mir-1-P1

Family name MIR-1 (all species)
Seed GGAAUGU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-1b
Paralogues Rno-Mir-1-P2  Rno-Mir-1-P3 
Orthologues Aae-Mir-1  Aca-Mir-1-P1  Ami-Mir-1-P1  Asu-Mir-1  Bfl-Mir-1  Bge-Mir-1  Bta-Mir-1-P1  Cbr-Mir-1  Cel-Mir-1  Cfa-Mir-1-P1  Cgi-Mir-1  Cin-Mir-1  Cli-Mir-1-P1  Cpi-Mir-1-P1  Cpo-Mir-1-P1  Cte-Mir-1  Dan-Mir-1  Dme-Mir-1  Dmo-Mir-1  Dno-Mir-1-P1  Dpu-Mir-1  Dre-Mir-1-P1  Ete-Mir-1-P1  Gga-Mir-1-P1  Hme-Mir-1  Hsa-Mir-1-P1  Isc-Mir-1  Lan-Mir-1  Lgi-Mir-1  Mdo-Mir-1-P1  Mml-Mir-1-P1  Mmu-Mir-1-P1  Oan-Mir-1-P1  Ocu-Mir-1-P1  Pfl-Mir-1  Pmi-Mir-1  Sha-Mir-1-P1  Sko-Mir-1  Spu-Mir-1  Sto-Mir-1-P1  Tca-Mir-1  Tgu-Mir-1-P1  Xtr-Mir-1-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr3: 175769728-175769788 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUGUGCACCCUGAACUACCUGCUUGGGACACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUUUCAGGCUAGGAACUCUCUCGCCAGACUGA
Get precursor sequence
Structure
        10         20         30        40        50        60
CCUGUGCACCCUGAACUA-   -|    GG C                GC     UGGACC 
                   CCU GCUUG  A ACAUACUUCUUUAUAU  CCAUA      U
                   GGA CGGAC  U UGUAUGAAGAAAUGUA  GGUAU      G
AGUCAGACCGCUCUCUCAA   U^    UU A                A-     CGAAUC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-1-P1_5p*

MirBase accessionNone
Sequence
0- ACAUACUUCUUUAUAUGCCCAUA -23
Get sequence
Mature sequence

Rno-Mir-1-P1_3p

MirBase accessionMIMAT0037263
Sequence
39- UGGAAUGUAAAGAAGUAUGUAU -61
Get sequence
Validated targets TargetScanVert: rno-miR-1b
miRDB: MIMAT0037263