MirGeneDB

MirGeneDB ID

Dpu-Mir-2-o1

Family name MIR-2 (all species)
Seed AUCACAG
Species Common water flea (Daphnia pulex)
MiRBase ID dpu-mir-2-1
Paralogues Dpu-Mir-2-o2  Dpu-Mir-2-o3  Dpu-Mir-2-o4  Dpu-Mir-2-o5  Dpu-Mir-2-o6 
Orthologues Dan-Mir-2-P1a-v1  Dan-Mir-2-P1a-v2  Dan-Mir-2-P1b-v1  Dan-Mir-2-P1b-v2  Dme-Mir-2-P1a-v1  Dme-Mir-2-P1a-v2  Dme-Mir-2-P1b-v1  Dme-Mir-2-P1b-v2  Dmo-Mir-2-P1a-v1  Dmo-Mir-2-P1a-v2  Dmo-Mir-2-P1b-v1  Dmo-Mir-2-P1b-v2 
Node of Origin (locus) D. pulex
Node of Origin (family) Protostomia
Genome context
(Daphnia_pulex.V1.0)
DAPPUscaffold_80: 240864-240934 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-2-o1)
Mir-71 DAPPUscaffold_80: 240430-240495 [+] Ensembl
Mir-2-o1 DAPPUscaffold_80: 240864-240934 [+] Ensembl
Mir-2-o2 DAPPUscaffold_80: 241044-241106 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUCGAGUUUGGUUUUCGCUACUACGUGCCGCUCGCAAAGUGGCUGUCAUGUGUCCCAAUUUCAAGUUUAGCGUUUCAUAUCACAGCCAGCUUUGAUGAGCGGGACGUUUUGUGGCCUUGCUCCCCCCUCGG
Get precursor sequence
Structure
        10        20          30          40        50        60    
AUCGAGUUUGGUUUUCGC   U--    G       -     -|      C     UCCCAAUUUCA 
                  UAC   ACGU CCGCUCG CAAAG UGGCUGU AUGUG           \
                  GUG   UGCA GGCGAGU GUUUC ACCGACA UAUAC           A
GGCUCCCCCCUCGUUCCG   UUU    G       A     G^      C     UUUGCGAUUUG 
 .       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Dpu-Mir-2-o1_5p*

MirBase accessionNone
Sequence
0- CUCGCAAAGUGGCUGUCAUGUG -22
Get sequence
Mature sequence

Dpu-Mir-2-o1_3p

MirBase accessionMIMAT0012657
Sequence
47- UAUCACAGCCAGCUUUGAUGAGCG -71
Get sequence