MirGeneDB

MirGeneDB ID

Dpu-Mir-279-o2

Family name MIR-279 (all species)
Seed GACUAGA
Species Common water flea (Daphnia pulex)
MiRBase ID dpu-mir-279b
Paralogues Dpu-Mir-279-o1  Dpu-Mir-279-o3  Dpu-Mir-279-o4  Dpu-Mir-279-o5  Dpu-Mir-279-o6 
Orthologues Aae-Mir-279-P2a  Aae-Mir-279-P2b1  Aae-Mir-279-P2b2  Cgi-Mir-279  Dan-Mir-279-P2  Dme-Mir-279-P2  Dmo-Mir-279-P2  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) D. pulex
Node of Origin (family) Protostomia
Genome context
(Daphnia_pulex.V1.0)
DAPPUscaffold_32: 68663-68726 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CUAGUUGAGCAUCUUGAGCAUACGUCAGUCGGCGAGUUCGGUUUUAGUUGUAUUUUAAAUUUAGUCGGUAUGACUAGAACCCACACUCGUCCGGUUGCUGUAUUCUAUUUCAUCGAGUAGGUCU
Get precursor sequence
Structure
        10          20        30          40        50        60
CUAGUUGAGCAUCUUGA-- C     U  GU   -     UC-|        UG  UUUUAAA 
                   G AUACG CA  CGG CGAGU   GGUUUUAGU  UA       U
                   C UAUGU GU  GCC GCUCA   CCAAGAUCA  AU       U
UCUGGAUGAGCUACUUUAU U     C  UG   U     CAC^        GU  GGCUGAU 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dpu-Mir-279-o2_5p*

MirBase accessionNone
Sequence
0- GGCGAGUUCGGUUUUAGUUGUA -22
Get sequence
Mature sequence

Dpu-Mir-279-o2_3p

MirBase accessionMIMAT0018923
Sequence
40- UGACUAGAACCCACACUCGUCCGG -64
Get sequence