MirGeneDB

MirGeneDB ID

Cli-Mir-551-P2

Family name MIR-551 (all species)
Seed CGACCCA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-551b
Paralogues Cli-Mir-551-P1 
Orthologues Aca-Mir-551-P2  Ami-Mir-551-P2  Bta-Mir-551-P2  Cfa-Mir-551-P2  Cpi-Mir-551-P2  Cpo-Mir-551-P2  Dno-Mir-551-P2  Dre-Mir-551-P2  Ete-Mir-551-P2  Gga-Mir-551-P2  Hsa-Mir-551-P2  Mdo-Mir-551-P2  Mml-Mir-551-P2  Mmu-Mir-551-P2  Oan-Mir-551-P2  Ocu-Mir-551-P2  Rno-Mir-551-P2  Sha-Mir-551-P2  Sto-Mir-551-P2  Tgu-Mir-551-P2  Xtr-Mir-551-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold698: 3540893-3540954 [-]
Precursor
(pre-Mir +30nt flank)
GCAGCUCGCCCAAAGCCGCCCCAUGGCUCCAGAAAUCAAGGGUGGGUAAGACCUCGUCAGCAAAGUUUAAGGCGACCCAUACUUGGUUUCAGGGGCUGUGUGGCUCUCGUCACCGCUGCGUA
Get precursor sequence
Structure
        10         20        30        40        50        60  
GCAGCUCGCCCAAAGCC-|  C         A         GG     AAGA   CGUCAGC 
                  GCC CAUGGCUCC GAAAUCAAG  UGGGU    CCU       \
                  CGG GUGUCGGGG CUUUGGUUC  ACCCA    GGA       A
AUGCGUCGCCACUGCUCU^  U         A         AU     GC--   AUUUGAA 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-551-P2_5p*

MirBase accessionMIMAT0038664
Sequence
0- AGAAAUCAAGGGUGGGUAAGACCU -24
Get sequence
Mature sequence

Cli-Mir-551-P2_3p

MirBase accessionMIMAT0038665
Sequence
41- GCGACCCAUACUUGGUUUCAG -62
Get sequence