MirGeneDB

MirGeneDB ID

Aca-Mir-551-P2

Family name MIR-551 (all species)
Seed AAAUCAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-551
Paralogues
Orthologues Ami-Mir-551-P2  Bta-Mir-551-P2  Cfa-Mir-551-P2  Cli-Mir-551-P2  Cpi-Mir-551-P2  Cpo-Mir-551-P2  Dno-Mir-551-P2  Dre-Mir-551-P2  Ete-Mir-551-P2  Gga-Mir-551-P2  Hsa-Mir-551-P2  Mdo-Mir-551-P2  Mml-Mir-551-P2  Mmu-Mir-551-P2  Oan-Mir-551-P2  Ocu-Mir-551-P2  Rno-Mir-551-P2  Sha-Mir-551-P2  Sto-Mir-551-P2  Tgu-Mir-551-P2  Xtr-Mir-551-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
3: 8820011-8820071 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUUCCUUUUUGGCAAUCUCAGUGGCUCCAGAAAUCAAGGUUGGGUGAGACCUCGUGAACAGACUGGAAGGCGACCCAUACUUGGUUUCAGGAGCUUCGAGGAUUUAUUCAUCAACCGUCC
Get precursor sequence
Structure
        10           20        30        40        50        60 
AAUUCCUUUUUGGCAAU---|  AGU      A         GU     GAGA   CGUGAAC 
                    CUC   GGCUCC GAAAUCAAG  UGGGU    CCU       \
                    GAG   UCGAGG CUUUGGUUC  ACCCA    GGA       A
CCUGCCAACUACUUAUUUAG^  CU-      A         AU     GC--   AGGUCAG 
 .       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-551-P2_5p

MirBase accessionNone
Sequence
0- GAAAUCAAGGUUGGGUGAGACCU -23
Get sequence
Co-mature sequence

Aca-Mir-551-P2_3p

MirBase accessionMIMAT0021982
Sequence
40- GCGACCCAUACUUGGUUUCAG -61
Get sequence