MirGeneDB

MirGeneDB ID

Sto-Mir-551-P2

Family name MIR-551 (all species)
Seed CGACCCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Aca-Mir-551-P2  Ami-Mir-551-P2  Bta-Mir-551-P2  Cfa-Mir-551-P2  Cli-Mir-551-P2  Cpi-Mir-551-P2  Cpo-Mir-551-P2  Dno-Mir-551-P2  Dre-Mir-551-P2  Ete-Mir-551-P2  Gga-Mir-551-P2  Hsa-Mir-551-P2  Mdo-Mir-551-P2  Mml-Mir-551-P2  Mmu-Mir-551-P2  Oan-Mir-551-P2  Ocu-Mir-551-P2  Rno-Mir-551-P2  Sha-Mir-551-P2  Tgu-Mir-551-P2  Xtr-Mir-551-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01000970.1: 352736-352795 [-]
Precursor
(pre-Mir +30nt flank)
AUCGACAACAGAAUAACCUUUCAGACCCUGGAAAUCAAGCUUGGGUGAGGCCUAUGACGUACAAAACAGGCGACCCAUACUUGGUUUCCGAGGCUGUGGGUGAUGAUCUUUGAGUGAACA
Get precursor sequence
Structure
        10           20        30        40        50        60
AUCGACAACAGAAUAAC---| UU   A  C           CU     GAG    AUGACG 
                    CU  CAG CC UGGAAAUCAAG  UGGGU   GCCU      U
                    GG  GUC GG GCCUUUGGUUC  ACCCA   CGGA      A
ACAAGUGAGUUUCUAGUAGU^ GU   -  A           AU     G--    CAAAAC 
.       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-551-P2_5p*

MirBase accessionNone
Sequence
0- GAAAUCAAGCUUGGGUGAGGCCU -23
Get sequence
Mature sequence

Sto-Mir-551-P2_3p

MirBase accessionNone
Sequence
39- GCGACCCAUACUUGGUUUCCG -60
Get sequence