MirGeneDB

MirGeneDB ID

Cli-Mir-551-P1

Family name MIR-551 (all species)
Seed CGACCCA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-551a
Paralogues Cli-Mir-551-P2 
Orthologues Ami-Mir-551-P1  Bta-Mir-551-P1  Cfa-Mir-551-P1  Cpi-Mir-551-P1  Hsa-Mir-551-P1  Mdo-Mir-551-P1  Mml-Mir-551-P1  Sha-Mir-551-P1  Xtr-Mir-551-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold693: 3837059-3837117 [-]
Precursor
(pre-Mir +30nt flank)
GCUCCGUGACGUCCGCUGUGCGUGACCUUGGAAAUCAAGUGUAGGUGGAGCCUGUGGCAGCGAUCAAGGCGACCCACACUUGGUUUCAAGGGUCCGCAGGGCAGCCUGGGGCACGUCCU
Get precursor sequence
Structure
        10           20        30        40        50          
GCUCCGUGACGUCCGCUG---|   U      G            A   GGA    GUGGCA 
                     UGCG GACCUU GAAAUCAAGUGU GGU   GCCU      \
                     ACGC CUGGGA CUUUGGUUCACA CCA   CGGA      G
UCCUGCACGGGGUCCGACGGG^   -      A            C   G--    ACUAGC 
       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
To
Star sequence

Cli-Mir-551-P1_5p*

MirBase accessionMIMAT0038662
Sequence
0- GAAAUCAAGUGUAGGUGGAGCCU -23
Get sequence
Mature sequence

Cli-Mir-551-P1_3p

MirBase accessionMIMAT0038663
Sequence
38- GCGACCCACACUUGGUUUCAA -59
Get sequence