MirGeneDB

MirGeneDB ID

Cli-Mir-155

Family name MIR-155 (all species)
Seed UAAUGCU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-155
Paralogues
Orthologues Aca-Mir-155  Ami-Mir-155  Bta-Mir-155  Cfa-Mir-155  Cpi-Mir-155  Cpo-Mir-155  Dno-Mir-155  Dre-Mir-155  Ete-Mir-155  Gga-Mir-155  Hsa-Mir-155  Mdo-Mir-155  Mml-Mir-155  Mmu-Mir-155  Oan-Mir-155  Ocu-Mir-155  Rno-Mir-155  Sha-Mir-155  Sto-Mir-155  Tgu-Mir-155  Xtr-Mir-155 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold101: 7953883-7953943 [-]
Precursor
(pre-Mir +30nt flank)
CUCUGGAGUUCUUCUGUAGGCUGUAUGUUGUUAAUGCUAAUCGUGAUAGGGGUUUUUACCUCUGACUGACUCCUACAUAUUAGCAUUAACACUGUAUCAUGCCUCUUACCAGAAUUCACAU
Get precursor sequence
Structure
        10        20          30        40        50        60 
CUCUGGAGUUCUUCUGUA   -  -|  GU             C   A        UUUACC 
                  GGC UG UAU  UGUUAAUGCUAAU GUG UAGGGGUU      \
                  CCG AC AUG  ACAAUUACGAUUA UAC AUCCUCAG      U
UACACUUAAGACCAUUCU   U  U^  UC             -   -        UCAGUC 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-155_5p

MirBase accessionMIMAT0038549
Sequence
0- UUAAUGCUAAUCGUGAUAGGGGUU -24
Get sequence
Star sequence

Cli-Mir-155_3p* (predicted)

MirBase accessionNone
Sequence
39- CUCCUACAUAUUAGCAUUAACA -61
Get sequence