MirGeneDB

MirGeneDB ID

Mmu-Mir-155

Family name MIR-155 (all species)
Seed UAAUGCU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-155
Paralogues
Orthologues Aca-Mir-155  Ami-Mir-155  Bta-Mir-155  Cfa-Mir-155  Cli-Mir-155  Cpi-Mir-155  Cpo-Mir-155  Dno-Mir-155  Dre-Mir-155  Ete-Mir-155  Gga-Mir-155  Hsa-Mir-155  Mdo-Mir-155  Mml-Mir-155  Oan-Mir-155  Ocu-Mir-155  Rno-Mir-155  Sha-Mir-155  Sto-Mir-155  Tgu-Mir-155  Xtr-Mir-155 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr16: 84714143-84714203 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCUGGAGGCUUGCUGAAGGCUGUAUGCUGUUAAUGCUAAUUGUGAUAGGGGUUUUGGCCUCUGACUGACUCCUACCUGUUAGCAUUAACAGGACACAAGGCCUGUUACUAGCACUCACAU
Get precursor sequence
Structure
        10        20          30        40        50        60 
UGCUGGAGGCUUGCUGAA    GUA  --|             UGUGA        UUGGCC 
                  GGCU   UG  CUGUUAAUGCUAAU     UAGGGGUU      \
                  CCGG   AC  GACAAUUACGAUUG     AUCCUCAG      U
UACACUCACGAUCAUUGU    AAC  AG^             UCC--        UCAGUC 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-155_5p

MirBase accessionMIMAT0000165
Sequence
0- UUAAUGCUAAUUGUGAUAGGGGUU -24
Get sequence
Validated targets microrna.org: MIMAT0000165
TargetScanVert: mmu-miR-155-5p
miRDB: MIMAT0000165
Star sequence

Mmu-Mir-155_3p*

MirBase accessionMIMAT0016993
Sequence
39- CUCCUACCUGUUAGCAUUAACA -61
Get sequence
Validated targets TargetScanVert: mmu-miR-155-3p
miRDB: MIMAT0016993