MirGeneDB

MirGeneDB ID

Sto-Mir-155

Family name MIR-155 (all species)
Seed UAAUGCU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Aca-Mir-155  Ami-Mir-155  Bta-Mir-155  Cfa-Mir-155  Cli-Mir-155  Cpi-Mir-155  Cpo-Mir-155  Dno-Mir-155  Dre-Mir-155  Ete-Mir-155  Gga-Mir-155  Hsa-Mir-155  Mdo-Mir-155  Mml-Mir-155  Mmu-Mir-155  Oan-Mir-155  Ocu-Mir-155  Rno-Mir-155  Sha-Mir-155  Tgu-Mir-155  Xtr-Mir-155 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01001827.1: 169614-169674 [+]
Precursor
(pre-Mir +30nt flank)
GUAAUUCUUCCUACUGAAGUCUUUAUGGACUUAAUGCUAAUUGUGAUAGGGGUUUUGAGUUCUGAUGAGCUCCUACAUAUUAGCAUUAGCUCUGUGAUGUGACUGUGGUCGACAGGUGUUU
Get precursor sequence
Structure
        10        20          30        40        50        60 
GUAAUUCUUCCUACUGAA   U--|      C           U   A        UUGAGU 
                  GUC   UUAUGGA UUAAUGCUAAU GUG UAGGGGUU      \
                  CAG   AGUGUCU GAUUACGAUUA UAC AUCCUCGA      U
UUUGUGGACAGCUGGUGU   UGU^      C           -   -        GUAGUC 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-155_5p

MirBase accessionNone
Sequence
0- UUAAUGCUAAUUGUGAUAGGGGUU -24
Get sequence
Star sequence

Sto-Mir-155_3p* (predicted)

MirBase accessionNone
Sequence
39- CUCCUACAUAUUAGCAUUAGCU -61
Get sequence