MirGeneDB

MirGeneDB ID

Aca-Mir-155

Family name MIR-155 (all species)
Seed UAAUGCU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-155
Paralogues
Orthologues Ami-Mir-155  Bta-Mir-155  Cfa-Mir-155  Cli-Mir-155  Cpi-Mir-155  Cpo-Mir-155  Dno-Mir-155  Dre-Mir-155  Ete-Mir-155  Gga-Mir-155  Hsa-Mir-155  Mdo-Mir-155  Mml-Mir-155  Mmu-Mir-155  Oan-Mir-155  Ocu-Mir-155  Rno-Mir-155  Sha-Mir-155  Sto-Mir-155  Tgu-Mir-155  Xtr-Mir-155 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
3: 148357602-148357662 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUCAGGAUUUCACCCGCAGACCACACGUUGUUAAUGCUAAUCGUGAUAGGGGUUUUUAUCUCUGACUGACUCCUACAUGUUAGCAUUAAGAAUGUGUAGUGCUUAUUCCCAGAACUGACAU
Get precursor sequence
Structure
        10          20        30        40        50        60 
GUCAGGAUUUCACCCGCAG--| C       G          U    A        UUUAUC 
                     AC ACACGUU UUAAUGCUAA CGUG UAGGGGUU      \
                     UG UGUGUAA AAUUACGAUU GUAC AUCCUCAG      U
UACAGUCAAGACCCUUAUUCG^ A       G          -    -        UCAGUC 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-155_5p

MirBase accessionMIMAT0021788
Sequence
0- UUAAUGCUAAUCGUGAUAGGGGUU -24
Get sequence
Star sequence

Aca-Mir-155_3p*

MirBase accessionMIMAT0021789
Sequence
39- CUCCUACAUGUUAGCAUUAAGA -61
Get sequence