MirGeneDB

MirGeneDB ID

Bta-Mir-188-P3

Family name MIR-188 (all species)
Seed ACCCAUU
Species Cow (Bos taurus)
MiRBase ID bta-mir-660
Paralogues Bta-Mir-188-P1  Bta-Mir-188-P2 
Orthologues Cfa-Mir-188-P3  Cpo-Mir-188-P3  Dno-Mir-188-P3  Ete-Mir-188-P3  Hsa-Mir-188-P3  Mml-Mir-188-P3  Ocu-Mir-188-P3 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chrX: 92901865-92901923 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-188-P3)
Mir-362-P6 chrX: 92893839-92893896 [+] UCSC Ensembl
Mir-362-P2-v2 chrX: 92897963-92898024 [+] UCSC Ensembl
Mir-362-P2-v3 chrX: 92897963-92898024 [+] UCSC Ensembl
Mir-362-P1 chrX: 92898446-92898504 [+] UCSC Ensembl
Mir-362-P5 chrX: 92899710-92899771 [+] UCSC Ensembl
Mir-188-P3 chrX: 92901865-92901923 [+] UCSC Ensembl
Mir-362-P4 chrX: 92903809-92903867 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGUAGAAGAAUGAACUGCUCCUUCUCCCGUACCCAUUGCAUAUCGGAGCUGUGAAUUCUCAAAGCACCUCCUAUGUGCAUGGAUUACAGGAGGGGGGAGCCCUGUCAUCAAGUGCCUU
Get precursor sequence
Structure
        10         20         30         40        50         
GUGUAGAAGAAUGAACU-   -        C   C-|   U      C    C   GAAUU 
                  GCU CCUUCUCC GUA  CCAU GCAUAU GGAG UGU     \
                  CGA GGGGGAGG CAU  GGUA CGUGUA CCUC ACG     C
UUCCGUGAACUACUGUCC   G        A   UA^   -      U    C   AAACU 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-188-P3_5p

MirBase accessionMIMAT0004344
Sequence
0- UACCCAUUGCAUAUCGGAGCUGU -23
Get sequence
Validated targets TargetScanVert: bta-miR-660
Star sequence

Bta-Mir-188-P3_3p*

MirBase accessionNone
Sequence
36- ACCUCCUAUGUGCAUGGAUUACA -59
Get sequence