MirGeneDB

MirGeneDB ID

Aca-Mir-460-P1

Family name MIR-460 (all species)
Seed CUGCAUU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-460a
Paralogues Aca-Mir-460-P2 
Orthologues Ami-Mir-460-P1  Cli-Mir-460-P1  Cpi-Mir-460-P1  Dre-Mir-460-P1  Gga-Mir-460-P1  Mdo-Mir-460-P1  Oan-Mir-460-P1  Sha-Mir-460-P1  Tgu-Mir-460-P1  Xtr-Mir-460-P1 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(anoCar2)
GL343687.1: 195346-195404 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUCCUCCGAGAUCUCCUGACCUUAUAGGACCUGCAUUGUACACACUGUGUGUAUGGACUGGAGGUGCACAGCGCAUACAAUGUGGAUGCUAUAGAAGUCAACAUCGGCGGCACAACUG
Get precursor sequence
Structure
        10         20         30        40        50         
UCUCCUCCGAGAUCUCC-    C-|     GAC UG       CACA      GUAUGGA 
                  UGAC  UUAUAG   C  CAUUGUA    CUGUGU       \
                  ACUG  GAUAUC   G  GUAACAU    GACACG       C
GUCAACACGGCGGCUACA    AA^     GUA GU       ACGC      UGGAGGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-460-P1_5p

MirBase accessionMIMAT0021970
Sequence
0- CCUGCAUUGUACACACUGUGUG -22
Get sequence
Star sequence

Aca-Mir-460-P1_3p*

MirBase accessionMIMAT0021971
Sequence
37- CACAGCGCAUACAAUGUGGAUG -59
Get sequence