MirGeneDB

MirGeneDB ID

Ami-Mir-193-P1a

Family name MIR-193 (all species)
Seed GGGUCUU
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-193a
Paralogues Ami-Mir-193-P1b  Ami-Mir-193-P2a  Ami-Mir-193-P2b 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Bge-Mir-193-P1  Bta-Mir-193-P1a  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cgi-Mir-193-P1  Cpi-Mir-193-P1a  Cpo-Mir-193-P1a  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Ete-Mir-193-P1a  Gga-Mir-193-P1a  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mml-Mir-193-P1a  Mmu-Mir-193-P1a  Oan-Mir-193-P1a  Ocu-Mir-193-P1a  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Sha-Mir-193-P1a  Tca-Mir-193-P1  Tgu-Mir-193-P1a 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(allMis1)
JH735928: 1184281-1184339 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GCGGGCGGCCGCACCAUGCGAGCUGAGGGCUGGGUCUUUGCGGGCGAGGUGAGAGGUUCGUGCGUUCAACUGGCCUACAAAGUCCCAGUUCUCGGCUCCCAGCACCGGCGGCCGGGCGC
Get precursor sequence
Structure
        10          20        30        40        50         
GCGGGCGGCCGCACCAU--|C               U     CG   G  G   GAGGUU 
                   G GAGCUGAGGGCUGGG CUUUG  GGC AG UGA      \
                   C CUCGGCUCUUGACCC GAAAC  CCG UC ACU      C
CGCGGGCCGGCGGCCACGA^C               U     AU   G  A   UGCGUG 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Ami-Mir-193-P1a_5p

MirBase accessionMIMAT0038208
Sequence
0- UGGGUCUUUGCGGGCGAGGUGA -22
Get sequence
Co-mature sequence

Ami-Mir-193-P1a_3p

MirBase accessionMIMAT0038209
Sequence
37- AACUGGCCUACAAAGUCCCAGU -59
Get sequence