MirGeneDB

MirGeneDB ID

Rno-Mir-193-P1a

Family name MIR-193 (all species)
Seed ACUGGCC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-193a
Paralogues Rno-Mir-193-P1b  Rno-Mir-193-P2a  Rno-Mir-193-P2b 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Bge-Mir-193-P1  Bta-Mir-193-P1a  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cgi-Mir-193-P1  Cpi-Mir-193-P1a  Cpo-Mir-193-P1a  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Ete-Mir-193-P1a  Gga-Mir-193-P1a  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mml-Mir-193-P1a  Mmu-Mir-193-P1a  Oan-Mir-193-P1a  Ocu-Mir-193-P1a  Pmi-Mir-193-P1  Sha-Mir-193-P1a  Tca-Mir-193-P1  Tgu-Mir-193-P1a 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr10: 67065915-67065970 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGAACUCCAAGGCGGACGGGAGCUGAGAGCUGGGUCUUUGCGGGCAAGAUGAGGGUGUCAGUUCAACUGGCCUACAAAGUCCCAGUCCUCGGCUCCCAGGACCGGCAUUUUCUCCA
Get precursor sequence
Structure
        10          20        30        40        50       
CGAACUCCAAGGCGGAC--|         AG     U     CG   A  A   GGGU 
                   GGGAGCUGAG  CUGGG CUUUG  GGC AG UGA    G
                   CCCUCGGCUC  GACCC GAAAC  CCG UC ACU    U
ACCUCUUUUACGGCCAGGA^         CU     U     AU   G  A   UGAC 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-193-P1a_5p*

MirBase accessionMIMAT0004736
Sequence
0- UGGGUCUUUGCGGGCAAGAUGA -22
Get sequence
Validated targets microrna.org: MIMAT0004736
TargetScanVert: rno-miR-193a-5p
miRDB: MIMAT0004736
Mature sequence

Rno-Mir-193-P1a_3p

MirBase accessionMIMAT0000868
Sequence
34- AACUGGCCUACAAAGUCCCAGU -56
Get sequence
Validated targets microrna.org: MIMAT0000868
TargetScanVert: rno-miR-193a-3p
miRDB: MIMAT0000868