MirGeneDB

MirGeneDB ID

Hme-Mir-193-P1

Family name MIR-193 (all species)
Seed ACUGGCC
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-193
Paralogues Hme-Mir-193-P2 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Ami-Mir-193-P1b  Bfl-Mir-193-P1e  Bfl-Mir-193-P1f  Bge-Mir-193-P1  Bta-Mir-193-P1a  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1a  Cpi-Mir-193-P1b  Cpo-Mir-193-P1a  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Dre-Mir-193-P1b  Efe-Mir-193-P1g  Efe-Mir-193-P1h  Ete-Mir-193-P1a  Ete-Mir-193-P1b  Gga-Mir-193-P1a  Gga-Mir-193-P1b  Hsa-Mir-193-P1a  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lan-Mir-193-P1i  Lan-Mir-193-P1j  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mdo-Mir-193-P1b  Mml-Mir-193-P1a  Mml-Mir-193-P1b  Mmu-Mir-193-P1a  Mmu-Mir-193-P1b  Oan-Mir-193-P1a  Oan-Mir-193-P1b  Ocu-Mir-193-P1a  Ocu-Mir-193-P1b  Pfl-Mir-193-P1c  Pfl-Mir-193-P1d  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Rno-Mir-193-P1b  Sha-Mir-193-P1a  Sha-Mir-193-P1b  Sko-Mir-193-P1c  Sko-Mir-193-P1d  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1a  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Hmel_1)
HE667780: 841382-841438 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P1)
Mir-193-P1 HE667780: 841382-841438 [+] Ensembl
Mir-193-P2 HE667780: 843563-843618 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAGAAACGAGAAUAUCCCAGCCUUGGUGAGGGUCUUGGCGGUCUAGUGGGUGUGCUCAGUUCUUACUGGCCUGCUAAGUCCCAAGCUAUGGUGGGAAUACGCAAGGAUCAUCAAC
Get precursor sequence
Structure
        10           20        30        40        50        
AGAAGAAACGAGAAUAU---|   G  U    GA   U        U        UGUGC 
                    CCCA CC UGGU  GGG CUUGGCGG CUAGUGGG     \
                    GGGU GG AUCG  CCC GAAUCGUC GGUCAUUC     U
CAACUACUAGGAACGCAUAA^   -  U    AA   U        C        UUGAC 
     110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-193-P1_5p*

MirBase accessionMIMAT0020538
Sequence
0- AGGGUCUUGGCGGUCUAGUGGG -22
Get sequence
Mature sequence

Hme-Mir-193-P1_3p

MirBase accessionMIMAT0020539
Sequence
35- UACUGGCCUGCUAAGUCCCAAG -57
Get sequence