MirGeneDB

Gene name

Dme-Mir-193-P1-v4

Family name MIR-193 (all species)
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-193
Paralogues Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Ami-Mir-193-P1b  Bfl-Mir-193-P1e  Bfl-Mir-193-P1f  Bge-Mir-193-P1  Bta-Mir-193-P1a  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1a  Cpi-Mir-193-P1b  Cpo-Mir-193-P1a  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Dre-Mir-193-P1b  Efe-Mir-193-P1g  Efe-Mir-193-P1h  Ete-Mir-193-P1a  Ete-Mir-193-P1b  Gga-Mir-193-P1a  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lan-Mir-193-P1i  Lan-Mir-193-P1j  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mdo-Mir-193-P1b  Mml-Mir-193-P1a  Mml-Mir-193-P1b  Mmu-Mir-193-P1a  Mmu-Mir-193-P1b  Oan-Mir-193-P1a  Oan-Mir-193-P1b  Ocu-Mir-193-P1a  Ocu-Mir-193-P1b  Pfl-Mir-193-P1c  Pfl-Mir-193-P1d  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Rno-Mir-193-P1b  Sha-Mir-193-P1a  Sha-Mir-193-P1b  Sko-Mir-193-P1c  Sko-Mir-193-P1d  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1a  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Drosophila
Node of Origin (family) Bilateria
Genome context
(dm6)
chr3L: 21574033-21574107 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P1-v4)
Mir-193-P1-v1 chr3L: 21574030-21574110 [+] UCSC Ensembl
Mir-193-P1-v2 chr3L: 21574031-21574109 [+] UCSC Ensembl
Mir-193-P1-v3 chr3L: 21574032-21574108 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUCGCAAUCCGUGUGUGCCCUUAUUAUGGUUGGGAUUUUUUAGAUCAGCAGUUAUUGCUAUAUAGCCAUAUUUAUAAAUCUUCUACUGGCCUACUAAGUCCCAACAUAAUGAGAGUAAAAACCACAGGUUCGACG
Get precursor sequence
Structure
        10           20        30        40        50        60       
AUCGCAAUCCGUGUGUGCC---|        G         UU   AU   C  UUAUUGCUAUAUAGC 
                      CUUAUUAUG UUGGGAUUU  UAG  CAG AG               \
                      GAGUAAUAC AACCCUGAA  AUC  GUC UC               C
GCAGCUUGGACACCAAAAAUGA^        -         UC   CG   A  UUCUAAAUAUUUAUA 
   130       120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-193-P1-v4_5p

MirBase accessionMIMAT0020849
Sequence
0- UGGGAUUUUUUAGAUCAGCAGU -22
Get sequence
Seed sequenceGGGAUUU
Co-mature sequence

Dme-Mir-193-P1-v4_3p

MirBase accessionMIMAT0005468
Sequence
53- UACUGGCCUACUAAGUCCCAAC -75
Get sequence
Seed sequenceACUGGCC
Validated targets microrna.org: MIMAT0005468
TargetScanFly: dme-miR-193