MirGeneDB

Gene name

Cel-Mir-193-P1-v2

Family name MIR-193 (all species)
Species Roundworm (Caenorhabditis elegans)
MiRBase ID cel-mir-240
Paralogues Cel-Mir-193-P1-v1  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Ami-Mir-193-P1b  Bfl-Mir-193-P1e  Bfl-Mir-193-P1f  Bge-Mir-193-P1  Bta-Mir-193-P1a  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1a  Cpi-Mir-193-P1b  Cpo-Mir-193-P1a  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Dre-Mir-193-P1b  Efe-Mir-193-P1g  Efe-Mir-193-P1h  Ete-Mir-193-P1a  Ete-Mir-193-P1b  Gga-Mir-193-P1a  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lan-Mir-193-P1i  Lan-Mir-193-P1j  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mdo-Mir-193-P1b  Mml-Mir-193-P1a  Mml-Mir-193-P1b  Mmu-Mir-193-P1a  Mmu-Mir-193-P1b  Oan-Mir-193-P1a  Oan-Mir-193-P1b  Ocu-Mir-193-P1a  Ocu-Mir-193-P1b  Pfl-Mir-193-P1c  Pfl-Mir-193-P1d  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Rno-Mir-193-P1b  Sha-Mir-193-P1a  Sha-Mir-193-P1b  Sko-Mir-193-P1c  Sko-Mir-193-P1d  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1a  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Caenorhabditis
Node of Origin (family) Bilateria
Genome context
(ce11)
chrX: 7882643-7882703 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P1-v2)
Mir-193-P1-v1 chrX: 7882643-7882703 [+] UCSC Ensembl
Mir-193-P2-v1 chrX: 7882766-7882826 [+] UCSC Ensembl
Mir-193-P2-v2 chrX: 7882766-7882826 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUAUUUCGUUGUUAGAAACUUUUUCAAAUCGAGGAUUUUGAGACUAGAAUGCUUGAAUUGUACUAGCAUACUGGCCCCCAAAUCUUCGCUUAGAAAUACAGUUCACAAUUAUUUUAAUGG
Get precursor sequence
Structure
        10        20          30        40        50          
GCUAUUUCGUUGUUAGAAACUU--|   A  U         UGAGA    A   CUUGAAU 
                        UUUC AA CGAGGAUUU     CUAG AUG       \
                        AAAG UU GCUUCUAAA     GGUC UAC       U
GGUAAUUUUAUUAACACUUGACAU^   A  C         CCCCC    A   GAUCAUG 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Wt Da Ea Mi Yo Yo
Star sequence

Cel-Mir-193-P1-v2_5p*

MirBase accessionMIMAT0015116
Sequence
0- CGAGGAUUUUGAGACUAGAAUG -22
Get sequence
Validated targets microrna.org: MIMAT0015116
Mature sequence

Cel-Mir-193-P1-v2_3p

MirBase accessionMIMAT0000296
Sequence
39- UACUGGCCCCCAAAUCUUCGCU -61
Get sequence
Seed sequenceACUGGCC
Validated targets microrna.org: MIMAT0000296
TargetScanWorm: cel-miR-240