MirGeneDB

Gene name

Tca-Mir-193-P1

Family name MIR-193 (all species)
Species Red flour beetle (Tribolium castaneum)
MiRBase ID tca-mir-193
Paralogues Tca-Mir-193-P2 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Ami-Mir-193-P1b  Bfl-Mir-193-P1e  Bfl-Mir-193-P1f  Bge-Mir-193-P1  Bta-Mir-193-P1a  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1a  Cpi-Mir-193-P1b  Cpo-Mir-193-P1a  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Dre-Mir-193-P1b  Efe-Mir-193-P1g  Efe-Mir-193-P1h  Ete-Mir-193-P1a  Ete-Mir-193-P1b  Gga-Mir-193-P1a  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lan-Mir-193-P1i  Lan-Mir-193-P1j  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mdo-Mir-193-P1b  Mml-Mir-193-P1a  Mml-Mir-193-P1b  Mmu-Mir-193-P1a  Mmu-Mir-193-P1b  Oan-Mir-193-P1a  Oan-Mir-193-P1b  Ocu-Mir-193-P1a  Ocu-Mir-193-P1b  Pfl-Mir-193-P1c  Pfl-Mir-193-P1d  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Rno-Mir-193-P1b  Sha-Mir-193-P1a  Sha-Mir-193-P1b  Sko-Mir-193-P1c  Sko-Mir-193-P1d  Sto-Mir-193-P1b  Tgu-Mir-193-P1a  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG8: 5228763-5228819 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P1)
Mir-193-P2 LG8: 5228629-5228689 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GAGGGCAGCAGCAAACUGGUCGUAAUGGUUUGGGCCUUAUAGGUUCAGUUGAUCAUUUUUAAAGCUACUGGCCUGUUAAGUCCCAAGUUAUUACAUUGCCGGAAGCUUCAGACUUCG
Get precursor sequence
Structure
        10        20          30         40        50        
GAGGGCAGCAGCAAACUGGUC--     GG      C   -|     U    UGAUCAUU 
                       GUAAU  UUUGGG CUU AUAGGU CAGU        \
                       CAUUA  GAACCC GAA UGUCCG GUCA        U
GCUUCAGACUUCGAAGGCCGUUA     UU      U   U^     -    UCGAAAUU 
     110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Ea Em Em Em Em Em Fe Fe Fe Fe Oo
Star sequence

Tca-Mir-193-P1_5p*

MirBase accessionMIMAT0018896
Sequence
0- UGGGCCUUAUAGGUUCAGUUGA -22
Get sequence
Mature sequence

Tca-Mir-193-P1_3p

MirBase accessionMIMAT0018897
Sequence
35- UACUGGCCUGUUAAGUCCCAAG -57
Get sequence
Seed sequenceACUGGCC