MirGeneDB

MirGeneDB ID

Pmi-Mir-193-P1

Family name MIR-193 (all species)
Seed GAGGUUG
Species Bat starfish (Patiria miniata)
MiRBase ID pmi-mir-193
Paralogues Pmi-Mir-193-P2 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Ami-Mir-193-P1b  Bfl-Mir-193-P1e  Bfl-Mir-193-P1f  Bge-Mir-193-P1  Bta-Mir-193-P1a  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1a  Cpi-Mir-193-P1b  Cpo-Mir-193-P1a  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Dre-Mir-193-P1b  Efe-Mir-193-P1g  Efe-Mir-193-P1h  Ete-Mir-193-P1a  Ete-Mir-193-P1b  Gga-Mir-193-P1a  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lan-Mir-193-P1i  Lan-Mir-193-P1j  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mdo-Mir-193-P1b  Mml-Mir-193-P1a  Mml-Mir-193-P1b  Mmu-Mir-193-P1a  Mmu-Mir-193-P1b  Oan-Mir-193-P1a  Oan-Mir-193-P1b  Ocu-Mir-193-P1a  Ocu-Mir-193-P1b  Pfl-Mir-193-P1c  Pfl-Mir-193-P1d  Rno-Mir-193-P1a  Rno-Mir-193-P1b  Sha-Mir-193-P1a  Sha-Mir-193-P1b  Sko-Mir-193-P1c  Sko-Mir-193-P1d  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1a  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pmin1)
JH779788.1: 5900-5962 [-]
Precursor
(pre-Mir +30nt flank)
CUUGGCGGAUACUCUAUUCUGGUUUGGGAACGAGGUUGUCCUGGGGCUCAGUAUGUGGGUCCAUAUCAUCAUACUGGCCAGCACAAUCCCGUUCUCAGGCUAUGACCAAACUCCAUCAGGAAG
Get precursor sequence
Structure
        10          20        30        40        50        60  
CUUGGCGGAUACUCUAU-  -|            A      C    GGC        UGGGUC 
                  UC UGGUUUGGGAACG GGUUGU CUGG   UCAGUAUG      C
                  AG AUCGGACUCUUGC CUAACA GACC   GGUCAUAC      A
GAAGGACUACCUCAAACC  U^            C      C    ---        UACUAU 
 120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em To
Mature sequence

Pmi-Mir-193-P1_5p

MirBase accessionNone
Sequence
0- CGAGGUUGUCCUGGGGCUCAGUAUG -25
Get sequence
Co-mature sequence

Pmi-Mir-193-P1_3p

MirBase accessionMIMAT0032164
Sequence
41- UACUGGCCAGCACAAUCCCGUU -63
Get sequence