MirGeneDB

MirGeneDB ID

Cgi-Mir-193-P1

Family name MIR-193 (all species)
Seed ACUGGCC
Species Pacific oyster (Crassostrea gigas)
MiRBase ID
Paralogues Cgi-Mir-193-P2 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Ami-Mir-193-P1b  Bfl-Mir-193-P1e  Bfl-Mir-193-P1f  Bge-Mir-193-P1  Bta-Mir-193-P1a  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cfa-Mir-193-P1b  Cli-Mir-193-P1b  Cpi-Mir-193-P1a  Cpi-Mir-193-P1b  Cpo-Mir-193-P1a  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Dre-Mir-193-P1b  Efe-Mir-193-P1g  Efe-Mir-193-P1h  Ete-Mir-193-P1a  Ete-Mir-193-P1b  Gga-Mir-193-P1a  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lan-Mir-193-P1i  Lan-Mir-193-P1j  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mdo-Mir-193-P1b  Mml-Mir-193-P1a  Mml-Mir-193-P1b  Mmu-Mir-193-P1a  Mmu-Mir-193-P1b  Oan-Mir-193-P1a  Oan-Mir-193-P1b  Ocu-Mir-193-P1a  Ocu-Mir-193-P1b  Pfl-Mir-193-P1c  Pfl-Mir-193-P1d  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Rno-Mir-193-P1b  Sha-Mir-193-P1a  Sha-Mir-193-P1b  Sko-Mir-193-P1c  Sko-Mir-193-P1d  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1a  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(CGI_GCA_000297895.1)
scaffold1144: 321631-321689 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AGAGACAAAUAAAGACUUCAUUCACUCGUUGGGGAGUUUGCGCGACAGUGUGUACAAGAUUUAAUCGUACUGGCCUGCAAAAUCCCAAAUGGAGUGGAAACGUUCUCAGCAGUGUAAUG
Get precursor sequence
Structure
        10        20          30        40        50         
AGAGACAAAUAAAGACUUCA-      -|   G    G      CGA       UACAAG 
                     UUCACU CGUU GGGA UUUGCG   CAGUGUG      \
                     AGGUGA GUAA CCCU AAACGU   GUCAUGC      A
GUAAUGUGACGACUCUUGCAA      G^   A    A      CCG       UAAUUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
A- D- D- Eg F- Gi He Ju L- Ma Ma Pe Re Sp Um Ea Fe Ha La Ma
Star sequence

Cgi-Mir-193-P1_5p*

MirBase accessionNone
Sequence
0- GGGGAGUUUGCGCGACAGUGUG -22
Get sequence
Mature sequence

Cgi-Mir-193-P1_3p

MirBase accessionNone
Sequence
37- UACUGGCCUGCAAAAUCCCAAA -59
Get sequence