
Gene name


Family name MIR-193 (all species)
Species Common water flea (Daphnia pulex)
MiRBase ID dpu-mir-193
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Ami-Mir-193-P1b  Bfl-Mir-193-P1e  Bfl-Mir-193-P1f  Bge-Mir-193-P1  Bta-Mir-193-P1a  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1a  Cpi-Mir-193-P1b  Cpo-Mir-193-P1a  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dno-Mir-193-P1b  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Dre-Mir-193-P1b  Efe-Mir-193-P1g  Efe-Mir-193-P1h  Ete-Mir-193-P1a  Ete-Mir-193-P1b  Gga-Mir-193-P1a  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lan-Mir-193-P1i  Lan-Mir-193-P1j  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mdo-Mir-193-P1b  Mml-Mir-193-P1a  Mml-Mir-193-P1b  Mmu-Mir-193-P1a  Mmu-Mir-193-P1b  Oan-Mir-193-P1a  Oan-Mir-193-P1b  Ocu-Mir-193-P1a  Ocu-Mir-193-P1b  Pfl-Mir-193-P1c  Pfl-Mir-193-P1d  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Rno-Mir-193-P1b  Sha-Mir-193-P1a  Sha-Mir-193-P1b  Sko-Mir-193-P1c  Sko-Mir-193-P1d  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1a  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
DAPPUscaffold_167: 85457-85514 [-] Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10          20        30        40        50         
AAAAAUCCAUACCGCAAU--|           C         UG AU   C    GAUUU 
                    GUUUUUACUUUU GGGAUUUAG  G  CAG UGUU     \
                    UAAAAGUGAAAA CCCUGAAUC  C  GUC AUAA     A
ACGACGACAUUUUAAACACU^           A         GU CG   -    AAUGU 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
Tissue expression
Star sequence


MirBase accessionNone
Get sequence
Mature sequence


MirBase accessionMIMAT0012643
Get sequence
Seed sequenceACUGGCC