MirGeneDB

MirGeneDB ID

Dpu-Mir-193-P1

Family name MIR-193 (all species)
Seed ACUGGCC
Species Common water flea (Daphnia pulex)
MiRBase ID dpu-mir-193
Paralogues
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Ami-Mir-193-P1b  Bfl-Mir-193-P1e  Bfl-Mir-193-P1f  Bge-Mir-193-P1  Bta-Mir-193-P1a  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1a  Cpi-Mir-193-P1b  Cpo-Mir-193-P1a  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dno-Mir-193-P1b  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Dre-Mir-193-P1b  Efe-Mir-193-P1g  Efe-Mir-193-P1h  Ete-Mir-193-P1a  Ete-Mir-193-P1b  Gga-Mir-193-P1a  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lan-Mir-193-P1i  Lan-Mir-193-P1j  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mdo-Mir-193-P1b  Mml-Mir-193-P1a  Mml-Mir-193-P1b  Mmu-Mir-193-P1a  Mmu-Mir-193-P1b  Oan-Mir-193-P1a  Oan-Mir-193-P1b  Ocu-Mir-193-P1a  Ocu-Mir-193-P1b  Pfl-Mir-193-P1c  Pfl-Mir-193-P1d  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Rno-Mir-193-P1b  Sha-Mir-193-P1a  Sha-Mir-193-P1b  Sko-Mir-193-P1c  Sko-Mir-193-P1d  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1a  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Daphnia_pulex.V1.0)
DAPPUscaffold_167: 85457-85514 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAAUCCAUACCGCAAUGUUUUUACUUUUCGGGAUUUAGUGGAUCAGCUGUUGAUUUAUGUAAAAUACUGGCCUGCUAAGUCCCAAAAAGUGAAAAUUCACAAAUUUUACAGCAGCA
Get precursor sequence
Structure
        10          20        30        40        50         
AAAAAUCCAUACCGCAAU--|           C         UG AU   C    GAUUU 
                    GUUUUUACUUUU GGGAUUUAG  G  CAG UGUU     \
                    UAAAAGUGAAAA CCCUGAAUC  C  GUC AUAA     A
ACGACGACAUUUUAAACACU^           A         GU CG   -    AAUGU 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Dpu-Mir-193-P1_5p*

MirBase accessionNone
Sequence
0- CGGGAUUUAGUGGAUCAGCUGUU -23
Get sequence
Mature sequence

Dpu-Mir-193-P1_3p

MirBase accessionMIMAT0012643
Sequence
36- UACUGGCCUGCUAAGUCCCAAA -58
Get sequence