MirGeneDB

MirGeneDB ID

Oan-Mir-193-P1a

Family name MIR-193 (all species)
Seed GGGUCUU
Species Platypus (Ornithorhynchus anatinus)
MiRBase ID
Paralogues Oan-Mir-193-P1b  Oan-Mir-193-P2a  Oan-Mir-193-P2b 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Bge-Mir-193-P1  Bta-Mir-193-P1a  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cgi-Mir-193-P1  Cpi-Mir-193-P1a  Cpo-Mir-193-P1a  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Ete-Mir-193-P1a  Gga-Mir-193-P1a  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mml-Mir-193-P1a  Mmu-Mir-193-P1a  Ocu-Mir-193-P1a  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Sha-Mir-193-P1a  Tca-Mir-193-P1  Tgu-Mir-193-P1a 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(mOrnAna1.p.v1_plustraces)
NC_041742.1: 2848676-2848732 [+]
Precursor
(pre-Mir +30nt flank)
GGCCCGCGGCGGGAGGACGGGGCCGAGAGCCGGGUCUUUGCGGGCGAGGUGAGGGCUUUCGGUUCAACUGGCCUUCAAAGUCCCAGUCCUCGCCCCCCAACACCGGCGCCUCCGCCC
Get precursor sequence
Structure
        10           20        30        40        50        
GGCCCGCGGCGGGAGGAC---|    C   AG C   U     C    G  G   GGGCU 
                     GGGGC GAG  C GGG CUUUG GGGC AG UGA     \
                     CCCCG CUC  G CCC GAAAC UCCG UC ACU     U
CCCGCCUCCGCGGCCACAACC^    -   CU A   U     U    G  A   UGGCU 
     110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Ce He Ki Te
Mature sequence

Oan-Mir-193-P1a_5p

MirBase accessionNone
Sequence
0- CGGGUCUUUGCGGGCGAGGUGA -22
Get sequence
Star sequence

Oan-Mir-193-P1a_3p*

MirBase accessionNone
Sequence
35- AACUGGCCUUCAAAGUCCCAGU -57
Get sequence