MirGeneDB

Gene name

Dno-Mir-193-P1a

Family name MIR-193 (all species)
MiRBase ID dno-mir-193a
Paralogues Dno-Mir-193-P1b  Dno-Mir-193-P2a  Dno-Mir-193-P2b 
Orthologues Aca-Mir-193-P1a  Ami-Mir-193-P1a  Bta-Mir-193-P1a  Cel-Mir-193-P1  Cfa-Mir-193-P1a  Cgi-Mir-193-P1  Cpi-Mir-193-P1a  Cpo-Mir-193-P1a  Cte-Mir-193-P1  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Ete-Mir-193-P1a  Gga-Mir-193-P1a  Hsa-Mir-193-P1a  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mml-Mir-193-P1a  Mmu-Mir-193-P1a  Ocu-Mir-193-P1a  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Sha-Mir-193-P1a  Tca-Mir-193-P1 
Node of Origin (gene) Teleostei
Node of Origin (family) Bilateria
Genome context
(dasNov3)
JH569875: 646493-646548 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACGCGAAUCGUGAGGAUGGGAGCUGAGGGCUGGGUCUUUGCGGGCGAGAUGAGGGUGUCGGUUCAACUGGCCUACAAAGUCCCAGUCCUCGGCCCCCAGGACCCGCGGCACCUCCC
Get precursor sequence
Structure
        10          20        30        40        50       
ACGCGAAUCGUGAGGAU--|  A             U     CG   G  A   GGGU 
                   GGG GCUGAGGGCUGGG CUUUG  GGC AG UGA    G
                   CCC CGGCUCCUGACCC GAAAC  CCG UC ACU    U
CCCUCCACGGCGCCCAGGA^  C             U     AU   G  A   UGGC 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Dno-Mir-193-P1a_5p*

MirBase accessionMIMAT0047721
Sequence
0- UGGGUCUUUGCGGGCGAGAUGA -22
Get sequence
Mature sequence

Dno-Mir-193-P1a_3p

MirBase accessionMIMAT0047722
Sequence
34- AACUGGCCUACAAAGUCCCAGU -56
Get sequence
Seed sequenceACUGGCC