MirGeneDB

MirGeneDB ID

Xtr-Mir-459

Family name MIR-459 (all species)
Seed CAGUAAC
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID
Paralogues
Orthologues Ami-Mir-459  Bta-Mir-459  Cfa-Mir-459  Cli-Mir-459  Cpi-Mir-459  Cpo-Mir-459  Dno-Mir-459  Dre-Mir-459  Ete-Mir-459  Hsa-Mir-459  Mml-Mir-459  Mmu-Mir-459  Oan-Mir-459  Ocu-Mir-459  Rno-Mir-459  Sto-Mir-459 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021650: 132695352-132695412 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GUAAUGUUUCCCAAAUCUGCUUUUUUGCUCUCAGUAACAACGAUUCAGCCUUGUCAUUAUUAUAUAACCAAGGGGAUCUUUGUCACUAAGUGCAAUUAAUAGCAACAUACGACAAGCCACC
Get precursor sequence
Structure
        10        20          30        40        50        60 
GUAAUGUUUCCCAAAUCU   UUU--|   U  C   A    C     AG     UCAUUAU 
                  GCU     UUGC CU AGU ACAA GAUUC  CCUUG       \
                  CGA     AACG GA UCA UGUU CUAGG  GGAAC       U
CCACCGAACAGCAUACAA   UAAUU^   U  A   C    U     --     CAAUAUA 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Em Em Em Em He
Mature sequence

Xtr-Mir-459_5p

MirBase accessionNone
Sequence
0- UCAGUAACAACGAUUCAGCCUUGU -24
Get sequence
Star sequence

Xtr-Mir-459_3p*

MirBase accessionNone
Sequence
39- AAGGGGAUCUUUGUCACUAAGU -61
Get sequence