MirGeneDB

MirGeneDB ID

Mmu-Mir-459

Family name MIR-459 (all species)
Seed CAGUAAC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-802
Paralogues
Orthologues Ami-Mir-459  Bta-Mir-459  Cfa-Mir-459  Cli-Mir-459  Cpi-Mir-459  Cpo-Mir-459  Dno-Mir-459  Dre-Mir-459  Ete-Mir-459  Hsa-Mir-459  Mml-Mir-459  Oan-Mir-459  Ocu-Mir-459  Rno-Mir-459  Sto-Mir-459  Xtr-Mir-459 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr16: 93369737-93369797 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCUACCGACUGCGGUCCUAUUAUUUGCAAUCAGUAACAAAGAUUCAUCCUUGUGUCAAUCAUACAACACGGAGAGUCUUUGUCACUCAGUGUAAUUAAUAGCCUUCACCUCGAAAGGGAA
Get precursor sequence
Structure
        10          20        30        40        50        60
ACCUACCGACUGCGGUC--|     U     AUC   A          A   U   GUCAA 
                   CUAUUA UUGCA   AGU ACAAAGAUUC UCC UGU     U
                   GAUAAU AAUGU   UCA UGUUUCUGAG AGG ACA     C
AAGGGAAAGCUCCACUUCC^     U     GAC   C          -   C   ACAUA 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-459_5p

MirBase accessionMIMAT0004188
Sequence
0- UCAGUAACAAAGAUUCAUCCUUGU -24
Get sequence
Validated targets microrna.org: MIMAT0004188
TargetScanVert: mmu-miR-802-5p
miRDB: MIMAT0004188
Star sequence

Mmu-Mir-459_3p*

MirBase accessionMIMAT0017240
Sequence
38- ACGGAGAGUCUUUGUCACUCAGU -61
Get sequence
Validated targets TargetScanVert: mmu-miR-802-3p
miRDB: MIMAT0017240