MirGeneDB ID | Mun-Mir-459 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-459 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Microcaecilia (Microcaecilia unicolor) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Ami-Mir-459 Bta-Mir-459 Cfa-Mir-459 Cja-Mir-459 Cli-Mir-459 Cpi-Mir-459 Cpo-Mir-459 Dno-Mir-459 Dre-Mir-459 Ebu-Mir-459 Eca-Mir-459 Ete-Mir-459 Gmo-Mir-459 Hsa-Mir-459 Laf-Mir-459 Loc-Mir-459 Mal-Mir-459 Mml-Mir-459 Mmr-Mir-459 Mmu-Mir-459 Oan-Mir-459 Ocu-Mir-459 Pab-Mir-459 Pma-Mir-459 Rno-Mir-459 Spt-Mir-459 Sto-Mir-459 Tni-Mir-459 Xla-Mir-459-P1 Xla-Mir-459-P2 Xtr-Mir-459 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_901765095.2_aMicUni1.2) |
LR594638.1: 67879828-67879892 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | CAGUAAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
CCAUGCUCUUCUCUUCUGUGUUGUCUGCUAUCAGUAACCAGAUAUCAUCCCUGCUGUGUAAACUCAAUGGUCAGGAAUGGUUCUUGUUACUUACUGCAUACAUCAGCUAAGUCUUCAGGAGAGCAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 CCAUGCUCUUCUCUUCU- GU-| C UAUC C U C CUGUGUAA GU UGU UGC AGUAAC AGA AUCAU CCUG A CG ACA ACG UCAUUG UCU UGGUA GGAC C ACGAGAGGACUUCUGAAU ACU^ U UCAU U - A UGGUAACU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | There is a one nt substitution at position 13 in the mature sequence between the source of the reads (Typhlonectes compressicauda) and the source of genomic sequence (Microcaecilia unicolor). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Mun-Mir-459_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- UCAGUAACCAGAUAUCAUCCCUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Mun-Mir-459_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
43- GGAAUGGUUCUUGUUACUUACU -65
Get sequence
|