MirGeneDB

MirGeneDB ID

Cpo-Mir-459

Family name MIR-459 (all species)
Seed AGGAGAA
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-802
Paralogues
Orthologues Ami-Mir-459  Bta-Mir-459  Cfa-Mir-459  Cli-Mir-459  Cpi-Mir-459  Dno-Mir-459  Dre-Mir-459  Ete-Mir-459  Hsa-Mir-459  Mml-Mir-459  Mmu-Mir-459  Oan-Mir-459  Ocu-Mir-459  Rno-Mir-459  Sto-Mir-459  Xtr-Mir-459 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(cavPor3)
scaffold_146: 392819-392879 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GAUCACCAUCAAGAUUUCUAUUAUUUGCAGUCAGUAACAAAGAUUCAUUCUUGUGUCAAUCACACAACAAGGAGAAUCUUUGUCACUUCAUGUAAUUAAUAGCUGAGCCACGCAUGGAAAG
Get precursor sequence
Structure
        10          20        30        40        50        60
GAUCACCAUCAAGAUUU--|     U     GUC   A          A       GUCAA 
                   CUAUUA UUGCA   AGU ACAAAGAUUC UUCUUGU     U
                   GAUAAU AAUGU   UCA UGUUUCUAAG AGGAACA     C
GAAAGGUACGCACCGAGUC^     U     ACU   C          -       ACACA 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cpo-Mir-459_5p* (predicted)

MirBase accessionMIMAT0047387
Sequence
0- UCAGUAACAAAGAUUCAUUCUUGU -24
Get sequence
Mature sequence

Cpo-Mir-459_3p

MirBase accessionMIMAT0047388
Sequence
38- AAGGAGAAUCUUUGUCACUUCAU -61
Get sequence