MirGeneDB

MirGeneDB ID

Ete-Mir-459

Family name MIR-459 (all species)
Seed CAGUAAC
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues
Orthologues Ami-Mir-459  Bta-Mir-459  Cfa-Mir-459  Cli-Mir-459  Cpi-Mir-459  Cpo-Mir-459  Dno-Mir-459  Dre-Mir-459  Hsa-Mir-459  Mml-Mir-459  Mmu-Mir-459  Oan-Mir-459  Ocu-Mir-459  Rno-Mir-459  Sto-Mir-459  Xtr-Mir-459 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(echTel2)
JH980294: 95364546-95364606 [-] UCSC
Precursor
(pre-Mir +30nt flank)
UGAUCACCACCAGACGUCUAUUACUUGCAGUCAGUAACAAAGAUUCAUCCUUGUGUCCAUCGAGCAGCAAGGAGAGUCUUUGUCACUUAGUGUAAUUAAUAGCUGUGCCUCGCGUGGAAAU
Get precursor sequence
Structure
        10          20        30        40        50        60
UGAUCACCACCAGACGU--|     C     GUC   A          A       GUCCA 
                   CUAUUA UUGCA   AGU ACAAAGAUUC UCCUUGU     U
                   GAUAAU AAUGU   UCA UGUUUCUGAG AGGAACG     C
UAAAGGUGCGCUCCGUGUC^     U     GAU   C          -       ACGAG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentThere is a one nucleotide polymorphism in the 5p arm in the assembled sequence relative to the read data.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Ete-Mir-459_5p

MirBase accessionNone
Sequence
0- UCAGUAACAAAGAUUCAUCCUUGU -24
Get sequence
Star sequence

Ete-Mir-459_3p*

MirBase accessionNone
Sequence
38- AAGGAGAGUCUUUGUCACUUAGU -61
Get sequence