MirGeneDB

MirGeneDB ID

Sto-Mir-459

Family name MIR-459 (all species)
Seed CAGUAAC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Ami-Mir-459  Bta-Mir-459  Cfa-Mir-459  Cli-Mir-459  Cpi-Mir-459  Cpo-Mir-459  Dno-Mir-459  Dre-Mir-459  Ete-Mir-459  Hsa-Mir-459  Mml-Mir-459  Mmu-Mir-459  Oan-Mir-459  Ocu-Mir-459  Rno-Mir-459  Xtr-Mir-459 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01004456.1: 233285-233346 [-]
Precursor
(pre-Mir +30nt flank)
AGCAACCCAAUUUAUUUCCAUUUGCUGCAAUCAGUAACAAGAAUUUGUCCCUUUGUGUCUUAAGUAUCUAAGGAGAAUUUUUGUUGCUUAGUGUAGUGAAUGGGCCUGAGUGGAUUUCUGCA
Get precursor sequence
Structure
        10          20        30        40        50        60 
AGCAACCCAAUUUAUUU--|    UG     AUC              G   CUUUGUGUCU 
                   CCAUU  CUGCA   AGUAACAAGAAUUU UCC          \
                   GGUAA  GAUGU   UCGUUGUUUUUAAG AGG          U
ACGUCUUUAGGUGAGUCCG^    GU     GAU              -   AAUCUAUGAA 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-459_5p

MirBase accessionNone
Sequence
0- UCAGUAACAAGAAUUUGUCCCU -22
Get sequence
Star sequence

Sto-Mir-459_3p* (predicted)

MirBase accessionNone
Sequence
42- GAGAAUUUUUGUUGCUUAGU -62
Get sequence