MirGeneDB

MirGeneDB ID

Dno-Mir-459

Family name MIR-459 (all species)
Seed CAGUAAC
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-802
Paralogues
Orthologues Ami-Mir-459  Bta-Mir-459  Cfa-Mir-459  Cli-Mir-459  Cpi-Mir-459  Cpo-Mir-459  Dre-Mir-459  Ete-Mir-459  Hsa-Mir-459  Mml-Mir-459  Mmu-Mir-459  Oan-Mir-459  Ocu-Mir-459  Rno-Mir-459  Sto-Mir-459  Xtr-Mir-459 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH573390: 2215448-2215508 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCUUGCCACCAGACUUCUAUUAUUUGCAUUCAGUAACAAAGUUUCAUCCUUGUGUCCAUCAAGCAACAAGGAGAAUCUUUGUCACUUGGUGUAAUUAAUAGCUGCACCUCGCAUGGAGUG
Get precursor sequence
Structure
        10          20        30        40        50        60
UGCUUGCCACCAGACUU--|     U      UC   A      U   A       GUCCA 
                   CUAUUA UUGCAU  AGU ACAAAG UUC UCCUUGU     U
                   GAUAAU AAUGUG  UCA UGUUUC AAG AGGAACA     C
GUGAGGUACGCUCCACGUC^     U      GU   C      U   -       ACGAA 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-459_5p

MirBase accessionMIMAT0048014
Sequence
0- UCAGUAACAAAGUUUCAUCCUUGU -24
Get sequence
Co-mature sequence

Dno-Mir-459_3p

MirBase accessionMIMAT0048015
Sequence
38- AAGGAGAAUCUUUGUCACUUGGU -61
Get sequence