| MirGeneDB ID | Pbv-Mir-19-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-19 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-19-P1a Pbv-Mir-19-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-19-P2c Ami-Mir-19-P2c Bta-Mir-19-P2c Cfa-Mir-19-P2c Cja-Mir-19-P2c Cli-Mir-19-P2c Cmi-Mir-19-P2c Cpi-Mir-19-P2c Cpo-Mir-19-P2c Dno-Mir-19-P2c Dre-Mir-19-P2c Eca-Mir-19-P2c Ete-Mir-19-P2c Gga-Mir-19-P2c Gja-Mir-19-P2c Gmo-Mir-19-P2c Hsa-Mir-19-P2c Laf-Mir-19-P2c Lch-Mir-19-P2c Mdo-Mir-19-P2c Mml-Mir-19-P2c Mmr-Mir-19-P2c Mmu-Mir-19-P2c Mun-Mir-19-P2c Neu-Mir-19-P2c Oan-Mir-19-P2c Ocu-Mir-19-P2c Pab-Mir-19-P2c Rno-Mir-19-P2c Sha-Mir-19-P2c Spt-Mir-19-P2c Sto-Mir-19-P2c Tgu-Mir-19-P2c Xla-Mir-19-P2c3 Xla-Mir-19-P2c4 Xtr-Mir-19-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE958055.1: 454-514 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-19-P2c) |
Mir-92-P2c
KE958055.1: 115-179 [-]
Mir-92-P1c KE958055.1: 286-347 [-] Mir-19-P2c KE958055.1: 454-514 [-] Mir-17-P4c KE958055.1: 600-662 [-] Mir-17-P2c KE958055.1: 3575-3639 [-] Mir-17-P1c KE958055.1: 3752-3809 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GUGCAAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GCUGAGAAGACUCCGUGCUGACCUACGGUGGGUUUUGCUGGUUUGCAUCUCAGCUUGGCGUCUGUUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUGGAGGUUGCGAGCAGGAAAAGUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GCUGAGAAGACUCCGUG----| G U G - - UCU UUGGC CU ACC ACGGU GGUUUUGC UGG UUUGCA CAGC G GG UGG UGUCA UCAAAACG ACC AAACGU GUCG U GUGAAAAGGACGAGCGUUGGA^ - - G U U --- UUGUC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-19-P2c_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGUUUUGCUGGUUUGCAUCUCAGC -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-19-P2c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UGUGCAAAUCCAUGCAAAACUGA -61
Get sequence
|
