MirGeneDB

MirGeneDB ID

Isc-Mir-281

Family name MIR-281 (all species)
Seed AGAGAGC
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues
Orthologues Aae-Mir-281  Asu-Mir-281  Bfl-Mir-281  Bge-Mir-281  Cbr-Mir-281-P3  Cbr-Mir-281-P4  Cel-Mir-281-P3  Cel-Mir-281-P4  Cgi-Mir-281  Cin-Mir-281  Cte-Mir-281  Dan-Mir-281-P1-v1  Dan-Mir-281-P1-v2  Dan-Mir-281-P2-v1  Dan-Mir-281-P2-v2  Dme-Mir-281-P1-v1  Dme-Mir-281-P1-v2  Dme-Mir-281-P2-v1  Dme-Mir-281-P2-v2  Dmo-Mir-281-P1-v1  Dmo-Mir-281-P1-v2  Dmo-Mir-281-P2-v1  Dmo-Mir-281-P2-v2  Dpu-Mir-281  Efe-Mir-281-P5  Efe-Mir-281-P6  Efe-Mir-281-P7  Hme-Mir-281  Lan-Mir-281-P9  Lan-Mir-281-P10  Lgi-Mir-281-P8  Lgi-Mir-281-P9  Pfl-Mir-281  Sko-Mir-281  Sto-Mir-281  Tca-Mir-281 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
1716747454: 337-400 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGCGACCAGGCGAGGCGGCCUGCUCCCGAAAGAGAGCAAUCCGUGGACAGUGUGUAUGUCCGAAAUGGAACUGUCAUGGAGUCGCUCUCUUUCGGGCGGGGCUCGCGGUACGCUAGCGAAAAA
Get precursor sequence
Structure
        10           20        30        40         50        60 
AAGCGACCAGGCGAGGC---|    GCU             AA-      G     GUGUAUGU 
                    GGCCU   CCCGAAAGAGAGC   UCCGUG ACAGU        C
                    UCGGG   GGGCUUUCUCUCG   AGGUAC UGUCA        C
AAAAAGCGAUCGCAUGGCGC^    GC-             CUG      -     AGGUAAAG 
  120       110       100         90        80         70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-281_5p

MirBase accessionNone
Sequence
0- AAGAGAGCAAUCCGUGGACAGU -22
Get sequence
Star sequence

Isc-Mir-281_3p*

MirBase accessionNone
Sequence
42- UGUCAUGGAGUCGCUCUCUUUC -64
Get sequence