MirGeneDB

MirGeneDB ID

Lgi-Mir-281-P9

Family name MIR-281 (all species)
Seed GUCAUGG
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-281
Paralogues Lgi-Mir-281-P8 
Orthologues Aae-Mir-281  Asu-Mir-281  Bfl-Mir-281  Bge-Mir-281  Cgi-Mir-281  Cin-Mir-281  Cte-Mir-281  Dpu-Mir-281  Hme-Mir-281  Isc-Mir-281  Lan-Mir-281-P9  Pfl-Mir-281  Sko-Mir-281  Sto-Mir-281  Tca-Mir-281 
Node of Origin (locus) L. gigantea
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_7: 642928-642984 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UCGAUUUUCAAGAUUCAAGAUCAAACGAUGAAGGGAGCAUCUGUCGACAGUUUGAAUUUAAAUACUGUCAUGGAGUUGCUCUCUUUACCGGGUUGGUCAAAUUCACCGAAAGUAAGU
Get precursor sequence
Structure
        10         20         30          40        50       
UCGAUUUUCAAGAUUCAA-      A-  A           --|    C      UUGAA 
                   GAUCAA  CG UGAAGGGAGCA  UCUGU GACAGU     U
                   CUGGUU  GC AUUUCUCUCGU  AGGUA CUGUCA     U
UGAAUGAAAGCCACUUAAA      GG  C           UG^    -      UAAAU 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-281-P9_5p* (predicted)

MirBase accessionMIMAT0009594
Sequence
0- AAGGGAGCAUCUGUCGACAGU -21
Get sequence
Mature sequence

Lgi-Mir-281-P9_3p

MirBase accessionMIMAT0009595
Sequence
35- UGUCAUGGAGUUGCUCUCUUUA -57
Get sequence